In vitro transcription t7 kit

Based on the base sequences of the four genes, the primers were designed including the T7 promoter (TAATACGACTCACTATAGGG) and GATCAC promotor group. The green fluorescence protein gene (GFP) was used as a control gene and the primers were designed as listed in Table 2. A large amount of the purified DNA template was obtained by PCR using the plasmid DNA containing the target gene as the template. Double-strand RNA was synthesized according to the In Vitro Transcription T7 Kit specification from Japan’s TaKaRa Company. The dsRNA was purified by using Easy Pure^® RNA Purification Kit from Beijing Quan-Shi Jin Company, and dsRNA homogeneity and concentration were determined by agarose gel electrophoresis and Nanodrop.

For RNAi in S2 cells, primers were designed as follows: Renilla-dsRNA-F (use as control) (5’- taatacgactcaatagggatgacgtvaaaagtttac −3’); Renilla-dsRNA-R (use as control) (5’- taatacgactcaatagggagactacatccggtttacc −3’); lola-dsRNA-F (5’- taatacgactcaatagggatggatgacgatcagcagtt −3’); lola-dsRNA-R (5’- taatacgactcaatagggcggctgccggtccgctggac −3’).
PCR reactions were used as templates for in vitro RNA production (in vitro Transcription T7 kit, Takara), and RNAs were purified using isopropyl-alcohol. dsRNAs were then annealed (68°C for 10 min and 37°C for 30 min). To perform knockdown experiment, S2 cells were diluted into 1 × 10⁶ cells ml⁻¹ with serum free medium for 1 hr starvation with 15 μg dsRNA.

RNF152 KO mice were generated using CRISPR-Cas9 methods^{56 (link)}. Briefly, guide RNA (gRNA) expression vectors were constructed for pGS3-T7-gRNA. The pGS3-T7-gRNA vector and the Cas9-encoding plasmids were linearized using DraI and NotI, respectively. The linearized templates were transcribed in vitro via run-off reactions using T7 RNA polymerase, the in vitro Transcription T7 Kit (Takara) and the Sp6 mMESSAGE mMACHINE Kit (Ambion), respectively. TE solution containing 25 ng/μL gRNA and 50 ng/μl Cas9 mRNA was injected into the cytoplasm of one-cell stage embryos. A mismatch-sensitive T7E1 assay was used to identify the founders. To confirm the modification in the founders, the PCR products from each founder were generated using the TA cloning kit (Takara) according to the manufacturer’s instructions. USP4 knockout mice were generated using TALEN methods as described previously^{57 (link)}. For USP4  KO mice, TALEN right arm is: 5′-ATCTTATTGACAGCCGGT-3′; left arm is: 5′-GTCAAAGCCCACATACT-3′; To confirm the frame-shift in the founders, the PCR products from each founder were generated using the TA cloning kit (Takara) according to the manufacturer’s instructions. PCR was used to identify the genotype of the offspring from the intercrossed mice.

The 3D gene of FMDV (GenBank accession no. DQ533483.2), the N gene of VSV (GenBank accession no. M31846.1) and VP7 of BTV (GenBank accession no. AY776331.1) were previously cloned into pEASY-T1, an in vitro transcription vector (Transgen Biotech, China) containing the T7 promoter priming site, generating the recombinant plasmids pEASY-FDMV-3D, pEASY-VSV-N, and pEASY-BTV-VP7. These plasmids were linearized by endonuclease enzymatic digestion using EcoRV. RNA transcription was performed using the In vitro Transcription T7 Kit (Takara, Dalian, China). Then, the RNA was purified using the EasyPure RNA Purification Kit (Transgen Biotech, China). The purified RNA transcripts obtained were then quantified by absorbance at 260 nm using a NanoDrop 2000 (ThermoFisher Scientific, Waltham, USA). Each concentration of the purified RNA transcripts was adjusted to 3.0 ×10⁹ copies/μL and mixed equally to prepare the RNA standards by serial 10-fold dilution with RNase-free H₂O. The standards contained the three in vitro‐transcribed RNAs with specific gene sequences of the three target viruses, and the concentrations of each RNA ranged from 1×10⁸ to 1 copies/μL. Two microliters of standard RNA transcript was used as a template in the mLAMP assay for analysis of the sensitivity of the mLAMP assay.

Oligos (60 bp, containing Cyp3a1 or Cyp3a2 knock out target-sites) and all primers for PCR were synthesized from Biosune Biotechnology Co. LTD (Shanghai, China). In vitro Transcription T7 Kit, SYBR Premix Ex Taq, Prime Script RT Reagent Kit and TA cloning kit were bought from Takara (Dalian, China). mMessage mMachine SP6 kit were purchased from Thermo Scientific (Massachusetts, USA). The secondary antibody conjugated to HRP-labeled polymers was bought from Mrbiotech (Shanghai, China). Midazolam was purchased from Enhua (Nanchang, China). Mebendazole was purchased from Aladdin (Shanghai, China).

The dsRNA fragments of two ELO genes which were used to silence the corresponding mRNA transcripts were synthesized using the in vitro Transcription T7 Kit (TAKARA)^{45 (link)} and the specific primers used are listed in Table 4. Plasmid pMD19-T vectors linked with amplified TmELO1 and TmELO2 were the templates. The quality and length of the dsRNA fragments were measured by BioDrop μLite (BioDrop, Cambridge, England) and electrophoresis. The fragments were purified and diluted into a final concentration of 1 μg/μl. All dsRNAs were stored at −20 °C. Each of the two ELO dsRNA were injected separately into mature larvae of T. molitor and EGFP dsRNA was used as the control. The larvae were collected 1d, 2d, 3d and 4d after injection, flash-frozen in liquid nitrogen and stored at −80 °C. Animals were observed daily and the death rate was recorded through the pupal and adult stages till two weeks after injection. Every sample contained 20 larvae (n = 3) which were injected with 5 μg dsRNA fragments.