Log In Sign up
The largest database of trusted experimental protocols

Stepone qpcr machine

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in France

The StepOne qPCR machine is a real-time PCR system designed for quantitative gene expression analysis. It features a 96-well format and is compatible with a wide range of fluorescent chemistries. The instrument provides fast and reliable PCR amplification and detection.

Automatically generated - may contain errors

Lab products found in correlation

Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (8 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (8 mentions) Trizol, by Thermo Fisher Scientific (8 mentions) Rneasy mini kit, by Qiagen (3 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions) Potter elvehjem homogenizer, by Dutscher (2 mentions) Iscript cdna synthesis kit, by Bio-Rad (2 mentions) Trizol regent, by Thermo Fisher Scientific (2 mentions) Lna mircury, by Qiagen (2 mentions) Express one step superscript qrt pcr kit, by Thermo Fisher Scientific (2 mentions) Rneasy kit, by Qiagen (2 mentions) Pierce bca kit, by Thermo Fisher Scientific (1 mentions) Qiazol reagent, by Qiagen (1 mentions) Takyon rox sybr 2x mastermix dttp blue, by Eurogentec (1 mentions) Ampure xp bead, by Beckman Coulter (1 mentions) Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions) Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Qiashredder, by Qiagen (1 mentions) Omniscript reverse transcription kit, by Qiagen (1 mentions) Taqman snp genotyping assay, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

StepOne machine StepOne qPCR QPCR machine StepOne

22 protocols using stepone qpcr machine

1

Quantitative Analysis of Peroxisomal Enzymes

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNeasy Mini kit (Qiagen, Courtaboeuf, France), iScript cDNA Synthesis Kit (Bio-Rad, Marnes-la-Coquette, France) MESA GREEN qPCR MasterMix Plus (Thermo Fischer Scientific, Illkirch, France), Applied Biosystem Step One QPCR machine (Thermo Fischer Scientific, Illkirch, France), Potter Elvehjem homogenizer (Dominique Dutscher, Issy-les-Moulineaux, France), Anti-ABCD1 and anti-ACOX1 (BioPeroxIL laboratory, Dijon, France), Anti-ABCD2 (ab 102948, Abcam, Cambridge, UK), anti-catalase (AF3398, R&D Systems, Minneapolis, MN, USA). Other chemicals were purchased from Sigma-Aldrich (Saint-Quentin-Fallavier, France).
Essadek S., Bouchab H., El Kebbaj R., Gondcaille C., El Kamouni S., Savary S., Vamecq J., Essamadi A., Cherkaoui-Malki M., Nasser B, & Andreoletti P. (2022). Effects of a Short-Term Lipopolysaccharides Challenge on Mouse Brain and Liver Peroxisomal Antioxidant and β-oxidative Functions: Protective Action of Argan Oil. Pharmaceuticals, 15(4), 465.
+ Open protocol
+ Expand
2

Assessing Peroxisomal Enzyme Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNeasy Mini kit and QIAzol reagent (Qiagen, Courtaboeuf, France); iScript cDNA Synthesis Kit (Bio-Rad, Marnes-la-Coquette, France); Takyon ROX SYBR 2X MasterMix dTTP blue (UF-RSMT-B0701, Eurogentec, Angers, France); Pierce™ BCA kit (Thermo Fisher Scientific, Illkirch, France). Applied Biosystem Step One QPCR machine (Thermo Fischer Scientific, Illkirch, France), Potter Elvehjem homogenizer (Dominique Dutscher, Issy-les-Moulineaux, France), Anti-ACOX1 (BioPeroxIL laboratory, Dijon, France), and anti-catalase (ab76024, Abcam, Paris, France). SuperSignal™ West Femto Maximum Sensitivity Substrate (ECL) Solutions (Thermo Fisher Scientific, Illkirch, France). Other chemicals were purchased from Sig-ma-Aldrich (Saint-Quentin-Fallavier, France).
Tahri-Joutey M., Saih F.E., El Kebbaj R., Gondcaille C., Vamecq J., Latruffe N., Lizard G., Savary S., Nasser B., Cherkaoui-Malki M, & Andreoletti P. (2022). Protective Effect of Nopal Cactus (Opuntia ficus-indica) Seed Oil against Short-Term Lipopolysaccharides-Induced Inflammation and Peroxisomal Functions Dysregulation in Mouse Brain and Liver. International Journal of Molecular Sciences, 23(19), 11849.
+ Open protocol
+ Expand
3

Illumina RNA Sequencing Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Illumina library preparation and sequencing were carried out by the Genomics Pipelines team at Earlham Institute. 1µg of total RNA per sample was processed using the NEBNext Ultra II Directional The ligated products were subjected to a bead-based purification using Beckman Coulter AMPure XP beads (A63880). Adaptor ligated DNA was then enriched by receiving 10 cycles of PCR; 30 secs at 98°C, 10 cycles of: 10 secs at 98°C, 75 secs at 65°C, 5 mins at 65°C, final hold at 4°C. Barcodes were incorporated during the PCR step. The resulting libraries underwent QC using PerkinElmer GX and a
High Sensitivity DNA chip (5067-4626), the concentration was determined with a High Sensitivity Qubit assay (Q32854) or plate reader. The final libraries were pooled, a qPCR was performed using a KAPA Illumina ABI library quantification kit (Roche Diagnostics, 7960204001) on a StepOne q-PCR machine (ThermoFisher), and then these were prepared for sequencing.
The library pool was diluted to 0.
Wright D.J., Hall N., Irish N., Man A., Glynn W., Mould A.W., Angeles A.D.L., Angiolini E., Swarbreck D., Gharbi K., Tunbridge E.M., & Haerty W. (2021). Long read sequencing reveals novel isoforms and insights into splicing regulation during cell state changes.
+ Open protocol
+ Expand
4

Quantitative Analysis of Gene Expression in iPSCs and EBs

Check if the same lab product or an alternative is used in the 5 most similar protocols
iPSCs and EBs were collected from cultured plates and lysed in TRIzol (Invitrogen). Total RNAs were isolated by the phenol/chloroform extracting method, and then were reverse-transcribed into cDNAs with the SuperScript™ III Reverse Transcriptase (Invitrogen). Quantitative PCR analysis was performed using SYBR Green PCR Master Mix (Applied Biosystems) and run on StepOne qPCR machine (Applied Biosystems). The gene expression data were analyzed using the ΔΔCT method and the values were normalized to the expression of the GAPDH housekeeping gene (Fig. 1F and G). Primers used in this study were listed in Table 2.
Akter M., Cui H., Chen Y.H, & Ding B. (2021). Generation of two induced pluripotent stem cell lines with heterozygous and homozygous GAG deletion in TOR1A gene from a healthy hiPSC line. Stem cell research, 56, 102536.
+ Open protocol
+ Expand
5

Quantitative PCR Analysis of iPSCs and EBs

Check if the same lab product or an alternative is used in the 5 most similar protocols
As previously report (Akter et al., 2021 ), cultured iPSCs and EBs were collected and lysed in TRIzol (Invitrogen). Total RNAs were extracted using the phenol/chloroform method, and then reverse-transcripted into cDNAs using the SuperScript™ III Reverse Transcriptase (Invitrogen). Quantitative PCR analysis was performed using SYBR Green PCR Master Mix (Applied Biosystems) and run on a StepOne qPCR machine (Applied Biosystems). The gene expression data were analyzed using the ΔΔCT method and the values were normalized to the expression of the housekeeping gene GAPDH (Fig. 1E and G). Primers used in this study were listed in Table 2.
Akter M., Cui H., Chen Y.H, & Ding B. (2022). Generation of gene-corrected isogenic control cell lines from a DYT1 dystonia patient iPSC line carrying a heterozygous GAG mutation in TOR1A gene. Stem cell research, 62, 102807.
+ Open protocol
+ Expand
6

Silencing HIF1α in Human Keratinocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
ON-TARGETplus SMARTpool Human Hif1α siRNA and ON-TARGETplus non-targeting scrambled control pool siRNAs were purchased from Dharmacon and transfected into HEKn cells using Lipofectamine RNAiMAX (Life Technologies) per the manufacturer’s instructions. Cell lysates were saved in TRK Lysis Buffer, and RNA was isolated using the EZNA RNA Kit (Omega Biotech). cDNA was synthesized from RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and analyzed using the StepOne qPCR machine and Power SYBR Green PCR Master Mix (Applied Bio-systems). The following target genes and primers are listed as follows: Hif1α (forward: CCCTAACGTGTTATCTGTCGCT; reverse: AGTAGCTGCATGATCG TCTGG); EGLN3 (forward: GCGTCTCCAAGCGACAC; reverse: TTTCCCGGA TAGCAAGCCAC); HK2 (forward: CAAAGTGACAGTGGGTGTGG; reverse: GCCAGGTCCTTCACTGTCTC); PFK1 (forward: AAGCATCATCGAAACGC TCTC; reverse: GGTGCCCGTGTCTTCTTTGT); and β-actin (forward: AGAGC TACGAGCTGCCTGAC; reverse: AGCACTGTGTTGGCGTACAG).
Wickersham M., Wachtel S., Lung T.W., Soong G., Jacquet R., Richardson A., Parker D, & Prince A. (2017). Metabolic Stress Drives Keratinocyte Defenses against Staphylococcus aureus Infection. Cell reports, 18(11), 2742-2751.
+ Open protocol
+ Expand
7

Quantitative PCR Analysis of iPSCs and EBs

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
As previously described (Akter et al., 2021 (link); 2022 (link)), iPSCs (P5) and EBs were collected from cultured plates and lysed in TRIzol (Invitrogen). A phenol/chloroform extraction method was used to isolate total RNAs and then perform reverse-transcription to synthesize cDNAs with the Superscript™ III Reverse Transcriptase (Invitrogen). SYBR Green PCR Master Mix (Applied Biosystems) was employed to perform quantitative PCR analysis using the StepOne qPCR machine (Applied Biosystems). The gene expression data were analyzed using the ΔΔCT method and the values were shown as the relative expression level to the housekeeping gene GAPDH. Primers used in this study were listed in Table 2.
Boeuf H., Reimund B., Jansen-Durr P, & Kédinger C. (1990). Differential activation of the E2F transcription factor by the adenovirus EIa and EIV products in F9 cells.. Proceedings of the National Academy of Sciences of the United States of America, 87(5), 1782-1786.
+ Open protocol
+ Expand
8

Transcriptomic Analysis of iPSCs and EBs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The iPSCs (P5) and EBs were collected from cultured plates using TRIzol regents (Invitrogen). Total RNAs were isolated by the phenol/chloroform extracting method, and then were reverse-transcripted into cDNAs with the SuperScript™ III Reverse Transcriptase (Invitrogen). Quantitative PCR analysis was performed using SYBR Green PCR Master Mix and run on StepOne qPCR machine (Applied Biosystems). The gene expression data were analyzed using the ΔΔCT method and the values were normalized to the expression of the housekeeping gene GAPDH. Primers used in this study are listed in Table 2.
Akter M., Cui H., Hosain M.A, & Ding B. (2023). Generation of two induced pluripotent stem cell lines with heterozygous and homozygous amyotrophic lateral sclerosis-causing mutation P525L (c.1574C > T) in FUS gene. Stem cell research, 69, 103103.
+ Open protocol
+ Expand
9

Quantitative Analysis of Gene Expression in iPSCs and EBs

Check if the same lab product or an alternative is used in the 5 most similar protocols
iPSCs and EBs were collected from cultured plates and lysed in TRIzol (Invitrogen). Total RNAs were isolated by the phenol/chloroform extracting method, and then were reverse-transcribed into cDNAs with the SuperScript™ III Reverse Transcriptase (Invitrogen). Quantitative PCR analysis was performed using SYBR Green PCR Master Mix (Applied Biosystems) and run on StepOne qPCR machine (Applied Biosystems). The gene expression data were analyzed using the ΔΔCT method and the values were normalized to the expression of the GAPDH housekeeping gene (Fig. 1F and G). Primers used in this study were listed in Table 2.
Akter M., Cui H., Chen Y.H, & Ding B. (2021). Generation of two induced pluripotent stem cell lines with heterozygous and homozygous GAG deletion in TOR1A gene from a healthy hiPSC line. Stem cell research, 56, 102536.
+ Open protocol
+ Expand
10

Quantitative gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted in triplicate from MEFs using Trizol (Thermo Scientific) and DNAase treated. cDNA was synthesised using the High-Capacity cDNA reverse transcription kit (Applied Biosystems) according to manufacturers instructions and analysed using an Applied Biosystems Step One qPCR machine. Relative expression of the target genes was normalised to actin levels. Data were extracted and analysed using Applied Biosystems 7500 software version 2.0 and Prism software. For each target mean fold change with standard error is presented.
RNA from mouse tissue was isolated from snap frozen tissues (n = 5 per group) using RNeasy Mini Kit and QIAshredder (Qiagen) according to manufacturers instructions. Total RNA was reverse-transcribed using Omniscript Reverse Transcription Kit (Qiagen) according to manufacturers instructions. Samples were analysed in triplicates using Power SyberR Green PCR Master Mix (Invitrogen) in a C1000TM Thermal Cycler, CFX96TM Real‐Time System (Bio‐Rad) using Bio‐Rad CXF Manager software. Expression was normalised to Pkg1. The sequences of all the primers used are included in Supplementary Table 2.
Carroll B., Otten E.G., Manni D., Stefanatos R., Menzies F.M., Smith G.R., Jurk D., Kenneth N., Wilkinson S., Passos J.F., Attems J., Veal E.A., Teyssou E., Seilhean D., Millecamps S., Eskelinen E.L., Bronowska A.K., Rubinsztein D.C., Sanz A, & Korolchuk V.I. (2018). Oxidation of SQSTM1/p62 mediates the link between redox state and protein homeostasis. Nature Communications, 9, 256.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!