Ab73537

The relationship between KLF10 and PDLIM2 was detected by SimpleChIP Kit (Cell Signaling Technology). 1% formaldehyde was used to crosslink with cells, and then the cells were lysed to prepare nuclei. Upon incubating the digested chromatin with anti‐KLF10 antibody (ab73537), anti‐PDLIM2 antibody (ab246868) or normal rabbit IgG (negative control; all from Abcam) at 4°C overnight, ChIP‐grade protein G magnetic beads were used to pull down the immune complexes. After eluting chromatin from the antibody/protein G magnetic beads, DNA was purified using the spin column provided with the kit (23 (link)).

Cell extracts were prepared in lysis buffer (RIPA Cell Lysis Buffer 5×, RP05-100, Visual Protein, Taiwan) that contained a 1× protease inhibitor mixture (4693132001, Roche) and 1 mM phenylmethylsulfonyl fluoride. For western blot analysis, cell extracts were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis. The electro-transferred membrane (Protran ™ Nitrocellulose membrane NBA 085C001EA) was then incubated with the secondary antibody (92668072, IRDye® 680RD Donkey anti-Mouse IgG; 92632211 IRDye® 800CW Donkey anti-Rabbit IgG; LI-COR Biosciences) and was developed with a LI-COR Odyssey system (LI-COR). We used Notch-1 (1:1000, ab8952, Abcam), Notch-3 (1:1000, ab23426, Abcam), Notch-4 (1:1000, ab199295, Abcam), phospho-AMP-activated protein kinase (AMPK; 1:500, E-ab-21121, Elabscience), c-Myc (1:1000, E-ab-30975, Elabscience), Hes7 (1:1000, E-ab-18076, Elabscience), RBX1 (1:1000, E-ab-18881, Elabscience), FBXW7 (1:1000, E-ab-11064, Elabscience), DLL1 (1:1000, E-ab-66262, Elabscience), Hes1 (1:200, sc166410, Santa Cruz) and Hey L (1:200, sc81294, Santa Cruz) to detect Notch pathway associated protein markers. The KLF10 antibody was purchased from Abcam (1:1000, ab73537). β-Actin antibody (1:1000, E-ab-20094, Elabscience) at a 1:3000 dilution was used as control.

ChIP assay was performed using the EZ‐Magna ChIP A/G kit (17‐10086; Millipore) according to the manufacturer's instruction. Briefly, sonicated chromatin complexes were immunoprecipitated using antibodies to KLF10 (ab73537; Abcam; 10 μg per reaction), acetyl‐histone H4 (06‐866; Millipore; 10 μg per reaction), Dnmt1 (ab13537; Abcam; 10 μg per reaction), and Dnmt3 (ab2850; Abcam; 10 μg per reaction). DNA fragments in the immunoprecipitates were extracted and subjected to quantitative PCR analysis. The PCR primers used in the study were as follows: 5′‐CTGGCAGGCAGGGAGGGAGG and 5′‐TGCAGCCTGCAAGGCTTCTC for the nephrin promoter region (−2,052/−1,753); 5′‐AGGGGGATAGTTCAGACTTC and 5′‐GAGGCCTCCTAGGACTCTCT for the nephrin promoter region (−1,802/−1,553).