AGS and BGC-823 human GC cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences (Shanghai, China), cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (Gibco, Grand Island, NY, USA) and 1% penicillin-streptomycin, and maintained at 37°C and 5% carbon dioxide. Recombinant lentiviral vectors for TPM4 RNAi (LV-TPM4) and lentiviral vectors for negative control (LV-Ctrl) were designed and packaged in 293T cells from GeneChem Co., Ltd. The TPM4 siRNA had the following sequence: 5′-GGAGGACAAATATGAAGAAGA-3′. The shTPM4/shCtrl cohorts had AGS/BGC-823 cells (5 × 103/well) subcultured in 96-well culture plates and infected with LV-TPM4/LV-Ctrl. The cells that were infected were selected by incubation with 2 µg/mL puromycin for 48 h. The efficiency for TPM4 knockdown was detected by western blotting.
293t cells
Manufactured by Genechem
Sourced in China, United States
293T cells are a type of human embryonic kidney cells commonly used in cell culture and research applications. They are known for their high transfection efficiency, making them a popular choice for expressing recombinant proteins and viral vector production.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Puromycin, by Beyotime (2 mentions)
Lentiviral vectors small hairpin rna shrna, by Genechem (2 mentions)
Polybrene, by Merck Group (2 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Ne per nuclear and cytoplasmic extraction reagent, by Thermo Fisher Scientific (2 mentions)
Microplate reader, by Thermo Fisher Scientific (2 mentions)
Prl tk, by Genechem (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Hyclone, by GE Healthcare (1 mentions)
Fugene hd transfection reagent, by Promega (1 mentions)
Plvx puro, by Takara Bio (1 mentions)
Hk 2 cell, by American Type Culture Collection (1 mentions)
Shrna actl8, by Genechem (1 mentions)
Shrna ctrl, by Genechem (1 mentions)
Columbia blood agar, by Merck Group (1 mentions)
Dmem f12, by Thermo Fisher Scientific (1 mentions)
Hct116, by Genechem (1 mentions)
Atcc 25586, by American Type Culture Collection (1 mentions)
18 protocols using 293t cells
1
TPM4 knockdown in GC cell lines
2
Exploring LAMC1 Promoter Regulation by HIF-1α
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Potential HIF-1α-binding sites in the LAMC1 promoter region were predicted using the JASPAR database (http://jaspar.genereg.net/ ) [16 (link)]. pGL4-based luciferase reporter plasmids containing wildtype and overexpressed LAMC1 promoters, a HIF-1α (NM_001530) overexpression plasmid, and Renilla internal reference plasmid pRL-TK were constructed by Genechem. The plasmids were co-transfected into 293 T cells Genechem), and luciferase activity was detected by the Dual-Luciferase Reporter Assay System (Cat#: E1910, Promega China, Beijing) at 48 h after transfection. Firefly and Renilla luminescence in sample wells was detected by a microplate reader. The Firefly/Renilla luminescence value represented luciferase activity. Each group was analyzed in three wells.
3
Lentiviral Transduction of ABCG2 in NCI-H929 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral particles were produced in 293T cells (Shanghai GeneChem Co., Ltd., Shanghai, China) [5×106 cells/ml, cultured in Dulbecco's modified Eagle's medium (DMEM; HyClone; GE Healthcare Life Sciences, Logan, UT, USA) containing 10% fetal bovine serum (HyClone; GE Healthcare Life Sciences] by transiently co-transfecting control vector pGV358 (DMEM, 37°C, 24 h) (obtained from Dr Van Duyne, University of Pennsylvania, Philadelphia, PA, USA) or pGV358-ABCG2 (ABCG2 cDNA was ontained from Shanghai GeneChem Co., Ltd.; GenBank accession no.: NM-004827, http://www.ncbi.nlm.nih.gov/genbank/ ) with helper plasmids pMD2.G (Plasmid #12259; Addgene, Inc., Cambridge, MA, USA) and psPAX2 (Plasmid #12260; Addgene, Inc.) using FuGENE® HD Transfection Reagent (Promega Corporation, Madison, WI, USA). A total of 24 h post-infection of NCI-H929 cells (5×105 cells/ml) with ABCG2 or non-specific control (NC) lentiviruses. The lentiviral supernatants were harvested post-transfection and were filtered (0.45 mM filter) prior to infection of the cell lines at 37°C for 24 h at a multiplicity of infection of 80, the cells were harvested and resuspended in fresh medium. These cells were referred to as NCI-H929/ABCG2+ or NCI-H929/NC cells.
4
Lentiviral p53 expression construct
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To create p53 expression construct, the protein coding sequence (CDS) region of murine p53 gene was synthesized and inserted into EcoRI/BamHI restriction sites of the lentiviral expression vector pLVX-puro (Clontech Laboratories, Inc., Palo Alto, CA, USA) by Genewiz, Inc. (Beijing, China). The construct was verified by DNA sequencing. 293T cells (Shanghai GeneChem Co., Ltd., Shanghai, China) were transfected with a mixture of plasmids, including viral packaging plasmids and p53 expression plasmid (pLVX-p53) or control plasmid (pLVX) via Lipofectamine 2000 (Invitrogen: Thermo Fisher Scientific, Inc., Carlsbad, CA, USA) based on the manufacturer's instructions. The viral supernatant was collected at 48 h after transfection and used to infect MC3T3-E1 cells. Evaluation of p53 expression was conducted at 48 h after viral infection.
5
Isolation and Culture of Renal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary RTECs were isolated and cultured as previously described 8 (link). The HK2 cells (human renal proximal tubular epithelial cell line) obtained from the American Type Culture Collection were cultured in the absence or presence of 10μM Pifithrin-α (PFTα, p53 inhibitor, #S2929, Selleck, USA) as previously outlined 37 (link). The 293T cells (Shanghai Genechem Co., LTD) were cultured following the provided instructions.
6
Silencing ACTL8 in 293T cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
shRNA‐ACTL8 and the scramble shRNA‐Ctrl were purchased from GeneChem Co., Ltd. (Shanghai, China). The experimental method was performed as previously described.12 An shRNA sequence against the human ACTL8 target sequence (TGGAGATCCTGTTTGAGTT) was screened and transfected into 293T cells (GeneChem, Shanghai, China) to generate shRNA‐ACTL8, while the shRNA‐Ctrl was used as the negative control. The sequences of shRNA‐ACTL8 and shRNA‐Ctrl were GCTGGAGATCCTGTTTGAGTT and TTCTCCGAACGTGTCACGT, respectively.
7
Bacterial Infection Assay in Human Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fn strain ATCC 25586 was purchased from American Type Culture Collection (ATCC) and grown in Columbia blood agar (Sigma, USA) in an anaerobic bag (Merier, France) at 37 °C as previously described [15 (link)]. HCT116, HT29 and 293 T cells were obtained from GeneChem and cultured in DMEM-F12(Gibco, USA) supplemented with 10% FBS (Gibco) and 1% penicillin and streptomycin (Beyotime, China) at 37 °C in a humidified 5% CO2 atmosphere. For Fn infection assay, cells were cultured in medium without antibiotics and incubated with Fn at a multiplicity of infection (MOI) of 100:1 as previously described [27 (link)].
8
METTL3 Knockdown Using Lentiviral shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral vectors (LV)-small hairpin RNA (shRNA) based on a third generation lentiviral system targeting METTL3 (LV-shMETTL3) and negative control (LV-shNC) were purchased from Shanghai GeneChem Co., Ltd. Briefly, 2.0 µg shRNA vector and 2.0 µg packaging mix plasmids were transfected into 293T cells (cat. no. C6008; Beyotime Institute of Biotechnology) using Lipofectamine 3000® reagent (Thermo Fisher Scientific, Inc.) for 24 h at 37°C, and the medium was then harvested and the virus was extracted by 85,000 × g ultracentrifugation at 4°C for 2 h in a centrifuge (Beckman Coulter, Inc.). For lentiviral transduction, the cells were seeded in six-well plates at a density of 50,000 cells/well. The lentiviral vector was added at a multiplicity of infection of 20, with 8 µg polybrene (Sigma-Aldrich; Merck KGaA) per well. After 72 h, the cells infected with the lentiviral vectors were selected using puromycin (Beyotime Institute of Biotechnology). The concentration of puromycin used for selection was 2 µg/ml, and the concentration used for maintenance was 1 µg/ml. The knockdown efficiency was evaluated using RT-qPCR.
9
Lentiviral Knockdown of TPM4 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant lentiviral vectors were designed and packaged in 293T cells by GeneChem (Shanghai, China). The sgRNA sequence designed based on the human TPM4 mRNA sequence was 5ʹ-TCTGCAGGTAGCTCGTAAGC-3.
For cellular infection, cells were subcultured at 6,000 cells/well in 96-well culture plate and infected with recombinant lentivirus. Stable clones were selected and identified by western blot.
For cellular infection, cells were subcultured at 6,000 cells/well in 96-well culture plate and infected with recombinant lentivirus. Stable clones were selected and identified by western blot.
10
Apoptosis Induction in Hepatocarcinoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A human hepatocarcinoma cell line (SK-hep1) was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). 293T cells and lentiviral vector GV358 were purchased from GeneChem (Shanghai, China). DMEM was purchased from Gibco (CA, USA). The Annexin V-FITC apoptosis detection kit, the NE-PER™ nuclear and cytoplasmic extraction reagents, and thyroid hormone receptor beta-1 antibody were purchased from (Thermo Fisher, MA, USA). Other reagents were obtained as follows: GAPDH antibody (Santa Cruz, CA, USA); the Bcl-2, 4-1BB, Bak, Histone H3, and active Caspase-3 antibodies (Bioss, Beijing, China); the TRIzol total RNA extraction reagent, the In-Fusion™ PCR cloning kit, and quantitative real-time PCR detection kit (Takara, Dalian, China); M-MLV reverse transcriptase (Invitrogen, CA, USA); KOD-Plus-Ver polymerase (TOYOBO, Tokyo, Japan); the Caspase-3 spectrophotometric assay kit (NANJING KEYGEN BIOTECH. CO., LTD, Nanjing, China); and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Promega, Beijing, China). Four-week-old female BALB/c nude mice (15–18 g) were obtained from Shanghai Lingchang BioTech CO., Ltd (Shanghai, China). Protocols involving animals used in this study were approved by the Institutional Animal Care and Use Committee of Weifang Medical University.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!