Cells (100,000) were seeded into 24-well plates and grown in supplemented RPMI 1640 medium (11 mM glucose), as described, but without any antibiotics. Transfection procedure were performed as previously described5 (link), using siRNA targeting Zip14 (ON-TARGET plus Rat Slc39a14 siRNA SMARTpool, Thermo Fischer Scientific) and, as a control, non-targeting siRNA (ON-TARGET plus Non-targeting siRNA, Thermo Fischer Scientific). The target sequences of the ZIP14 siRNA were as follows: GUAUAUUGCUCUAGCCGAU, GCUCAAAGGGGUUCGAUAU, CCACAACUUCAGUGAGCGA, and GAGCUGGGAGACUUCGUUA. The transfection efficiency was assessed by measurement of mRNA expression levels in all experiments and investigated once at the protein level using targeted proteomic analysis, as described below.
On targetplus non targeting sirna
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ON-TARGETplus non-targeting siRNA is a synthetic, double-stranded RNA molecule designed for use as a control in RNA interference (RNAi) experiments. Its core function is to serve as a negative control, exhibiting no known targeting of any gene transcript in mammalian cells.
Automatically generated - may contain errors
Lab products found in correlation
On targetplus smartpool human sirnas, by Thermo Fisher Scientific (2 mentions)
Stx18, by Eurofins (2 mentions)
Tango1 sirna, by Eurofins (2 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Lipofectamine ltx, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions)
Sybr green 1, by Thermo Fisher Scientific (1 mentions)
1 kb plus dna ladder, by Thermo Fisher Scientific (1 mentions)
Taqman probe, by Thermo Fisher Scientific (1 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (1 mentions)
Rnase inhibitor, by New England Biolabs (1 mentions)
Exosap it for pcr product cleanup, by Thermo Fisher Scientific (1 mentions)
On targetplus smartpool, by Thermo Fisher Scientific (1 mentions)
Interferin, by Polyplus Transfection (1 mentions)
Dharmafect 1 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
15 protocols using on targetplus non targeting sirna
1
Zip14 Silencing in Rat Cell Culture
2
Amplifying and Analyzing Mouse p62 Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse p62 open reading frame was amplified from N2a58 cDNA with primers of mp62-BamHI-F (5′-cgcggatccgcggttatggcgtcgttcacg-3′) and mp62-XhoI-R (5′-ccgctcgagtcattaagcgtaatctggaacatcgtatgggtacaatggtggagggtgctt-3′). UBA domain-deleted p62 (p62ΔUBA, missing amino acids 388–442) was amplified with primers of mp62-BamHI-F and mp62ΔUBA-XhoI-R (5′-ccgctcgagtcattaagcgtaatctggaacatcgtatgggtaatgtgggtatagggcagcttc-3′). phosphomimic p62 was amplified with primers of mp62 (S405E)-BamHI-F (5′-tcccagatgctggagatgggcttctctgat-3′) and mp62 (S405E)-XhoI-R (5′-atcagagaagcccatctccagcatctggga-3′). Amplified PCR fragments were inserted into the BamHI and XhoI sites of expression plasmid pcDNA3.1 (Invitrogen) and confirmed by sequential analysis. All plasmids were introduced by Lipofectamine LTX (Invitrogen) in prion-infected cells and analyzed 48 h after transfection. ON-TARGETplus small interference RNA (siRNA) against mouse p62 (J-047628-12-0005) was purchased from Thermo Scientific as well as the control ON-TARGETplus non-targeting siRNA (D-001810-01-05). Transfection with siRNAs was carried out with Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol.
3
Mouse Stat1 Overexpression and Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For over-expression of mouse Stat1, 2.5 kb of mouse Stat1 CDS was cloned under CMV promoter using pEGFPN3 plasmid (Promega). The sequence for primers is given below:
Stat1 FP: ATATCTCGAGCGGAGACAGCCCAGTAAGTC
Stat1 RP: ATATGGATCCCAGCASTGCTCAGCAAATGT
For knockdown experiments, 100 nM of Stat1siRNA (sigenome)/negative control siRNA was transfected into Neuro-2a cells for 48 h. ON-TARGET plus non-targeting siRNA (Thermo scientific D-001810-01) was used as negative control. miR-322 was cloned from mouse genomic DNA using primers flanking the pre-miRNA sequences. The amplified product of approximately 110 bp was cloned in pSilencer 4.1 CMV Neo Vector using BamHI and HindIII sites.
Stat1 FP: ATATCTCGAGCGGAGACAGCCCAGTAAGTC
Stat1 RP: ATATGGATCCCAGCASTGCTCAGCAAATGT
For knockdown experiments, 100 nM of Stat1siRNA (sigenome)/negative control siRNA was transfected into Neuro-2a cells for 48 h. ON-TARGET plus non-targeting siRNA (Thermo scientific D-001810-01) was used as negative control. miR-322 was cloned from mouse genomic DNA using primers flanking the pre-miRNA sequences. The amplified product of approximately 110 bp was cloned in pSilencer 4.1 CMV Neo Vector using BamHI and HindIII sites.
4
Quantitative miRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNase inhibitor was acquired from New England Bio-Labs (M0314L). DNA primers and RNA oligos were synthesized by Sigma-Aldrich. High-capacity cDNA first-strand synthesis kit, TaqMan Gene Expression Master Mix and TaqMan probes for miRNA quantification were purchased from Applied Biosystems (Life Technologies). The miRCURY LNA inhibitor against hsa-miR-98 was obtained from Exiqon. ExoSAP-IT for PCR Product Cleanup was obtained from Affymetrix. TRIzol LS Reagent, SYBR Green I and 1 Kb-Plus DNA Ladder were obtained from Invitrogen (Life Technologies). Rabbit anti-Ago2 monoclonal antibody was purchased from Cell Signaling Technology. SiGENOME SMARTpool-EIF2C2 anti-Ago2 and ON-TARGET plus non-targeting siRNA as nonspecific controls (siR-NSCs) were purchased from Thermo Scientific.
5
Targeting HIF-1α and HIF-2α in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ON-TARGETplus SMARTpool human siRNAs against HIF-1α (L-004018-00-0020), HIF-2α (L-004814-00-0020), and ON-TARGETplus non-targeting siRNA (D-001810-10-05) were synthesized by Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Cells were then transfected with the indicated siRNAs at 50 nM for 48 h using DharmaFECT transfection agent (Dharmacon Research, CO, USA) according to the manufacturer’s instructions.
6
Knockdown of Nrf2 and AHR in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ON-TARGETplus SMARTpool human Nrf2 siRNA (L-004018-00-0020), ON-TARGETplus SMARTpool human AHR siRNA (L-004990-00-0020), and ON-TARGETplus non-targeting siRNA (D-001810-10-05) were obtained from Thermo Fisher Scientific, Inc. The cells were transfected with the indicated siRNAs at 50 nM for 24 h using the DharmaFECT transfection agent (Dharmacon Research, Lafayette, CO, USA) according to the manufacturer’s instructions.
7
VE-Cadherin and Polarity Protein Depletion in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To deplete VE-cadherin in HUVECs, we used the siRNA oligonucleotide 5′-AGAUGCAGAGGCUCAUGAUTT-3′ (Schafer et al., 2003 (link)). As control siRNA, we used a nontargeting siRNA (On-TARGETplus Non-targeting siRNA; Thermo Fisher Scientific). For lentiviral down-regulation of VE-cadherin in HUVECs, the oligonucleotides 5′-CGCGTCCCCAGATGCAGAGGCTCATGATTTCAAGAGAATCATGAGCCTCTGCATCTTTTTTGGAAAT-3′ and 5′-CGATTTCCAAAAAAGATGCAGAGGCTCATGATTCTCTTGAAATCATGAGCCTCTGCATCTGGGGA-3′ were annealed and cloned into the shRNA expression vector pLVTHM. As negative control, the oligonucleotides 5′-CGCGTCCCCGGCAGCACAACTGCACTTGTT CAAGAGACAAGTGCAGTTGTGCTGCCTTTTTGGAAAT-3′ and 5′-CGATTTCCAAAAAGGCAGCACAACTGCACTTGTCTCTTGAACAAGTGCAGTTGTGCGCCGGGGA-3′ were annealed and cloned into pLVTHM. These two oligos encode for a shRNA not targeting human VE-cadherin. Knockdown of Pals1 was performed using a commercially available pool of three Pals1-specific shRNA–encoding lentiviral vector plasmids (sc-43991-SH; Santa Cruz Biotechnology). Knockdown of Par3 was performed using a lentiviral shRNA plasmid targeting human PARD3 (RHS3979-201817648; Dharmacon).
8
Silencing HIF-1α and HIF-2α in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ON-TARGETplus SMARTpool human siRNAs against HIF-1α (L-004018-00-0020), HIF-2α (L-004814-00-0020), and ON-TARGETplus non-targeting siRNA (D-001810-10-05) were synthesized by Thermo Fisher Scientific, Inc. (Waltham, MA, USA). The expression plasmid for HIF-1α was purchased from OriGene (Rockville, MD, USA). The cells were then transfected with the indicated siRNAs at 50 nM, or along with the HIF-1α-expression plasmid for 48 h using the DharmaFECT transfection agent (Dharmacon Research, CO, USA), according to the manufacturer’s instructions.
9
Knockdown of Human XBP1 in RA SF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human XBP1 was targeted for knock down by RNA interference using siRNA (ON-TARGET plus SMART pool, Thermo Scientific) in RA SF for 48 h. Non-targeting control (ON-TARGET plus Non-targeting siRNA, Thermo Scientific) was also used according to manufacturers' instructions.
10
DDX19B and NXF1 Knockdown by siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In total, two siRNA duplexes targeting different reading frames of DDX19B and NXF1 (Dharmacon, Lafayette, CO, USA) were used for RNAi-mediated knockdown. ON-TARGETplus non-targeting siRNA (Thermo Scientific, Waltham, MA, USA) was used for the siRNA control. The siRNA transfections were done using INTERFERin (Polyplus-transfection) at 10 nM. Depletion was verified by preparing J82 total cell lysates 48 apost-RNAi treatment and analyzing by qRT-PCR.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!