Lentiguide puro plasmid

Lentiviral constructs expressing CRISPR-associated protein 9 (Cas9) and guide RNAs (gRNAs) originally generated from Feng Zhang’s lab were obtained from Addgene (Cambridge, MA). We first established MM.1 s stably expressing Cas9 by infection of MM.1 s with lentivirus expressing Cas9. A total of three gRNAs targeting NCOR2 were selected from CRISPR pooled libraries generated from Dr. Brunello Doench, including NCOR2 #1 AGGGATCCCTCGGTCCTACG; NCOR2 #2 GACAGCGCCATCACATACCG; NCOR2 #3 GCTGCTGCAAGATCTCATCG. They were synthesized and cloned into the Lentiguide-puro plasmid (#52963) purchased from Addgene. Lentivirus harboring nontargeting vector (Vec) and all gRNA expression constructs were generated and used to infect MM.1 s at day 3 after infection, puromycin was added to the media (5 μg/ml) in order to select infected cells. The expression of NCOR2 in sorted cells was further evaluated by immunoblotting assay and qPCR.

For CRISPR/gRNA studies, Cas9 knock-in mice from Jackson Laboratory (Strain# 024857) (Platt et al., 2014 (link)) were bred to mice expressing CRE recombinase under control of mouse beta-Actin promoter. From this breeding, E13.5 embryos were dissected and embryonic DRGs seeded and cultured as described above. For analysis of NMNAT2 protein levels after depletion of MKK4/7, DRGs were infected with lentivirus on DIV1. Cells were lysed on DIV 8 and cell extracts analyzed by western immunoblotting. For suppression of axon protection experiments, DRGs were infected with Bcl-XL and shRNAs on DIV 3 and gRNA to Nmnat2 or scrambled control on DIV 4. Axons were not fragmented spontaneously with gRNA to Nmnat2 during the course of the experiment. Scrambled gRNAs (CGTCGCCGGCGAATTGACGG and CGCGGCAGCCGGTAGCTATG), Map2k4 (MKK4) gRNAs (TTGTTTTACAGGGCGACTGT and TTTGTAAAACTTATCGAACG), Map2k7 (MKK7) gRNAs (TTGCAGCAAATGCGGCGCT and CCAAAGCACTGAACGATGTA), Nmnat2 gRNA (GGAGCCCACCTGTTTTCCGT). gRNAs were designed with help from the Genome Engineering and iPSC center. gRNA sequences were cloned into LentiGuide-puro plasmid (Addgene # 52963).

To deplete K‐Ras expression in Y1 cells, we designed and tested five different specific gRNAs against the k‐ras gene using CRISPR design tool (http://crispr.mit.edu/). A scramble sequence was also designed for control. Sequences are shown below (Table 1).
Oligos were cloned into LentiGuide‐Puro plasmid (a gift from Feng Zhang, Addgene plasmid # 52963) according to described by Sanjana et al. (2014). For lentivirus production, LentiGuide‐Puro constructs, psPAX2 (a gift from Didier Trono, Addgene plasmid # 12260) and pCMV‐VSV‐G (a gift from Robert Weinberg, Addgene plasmid # 8454), were transfected into HEK293T cells using lipofectamine 3000 reagent according to manufacturer's protocol. Forty‐eight hours after transfection, viral supernatants were collected and filtered. Y1 cells were then cotransduced with the LentiCas9‐Blast and the individual LentiGuide‐Puro constructs in presence of 8 μg·mL⁻¹ of polybrene (sc‐134220; Santa Cruz Biotechnology). Forty‐eight hours after Y1 transduction, cells were selected with 3 μg·mL⁻¹ of puromycin and 7 μg·mL⁻¹ of blasticidin for 7 days before testing knock‐out efficiency. For all experiments here, we used the subline 4 (hereafter Y1ΔK), which displayed the lower levels of K‐Ras expression.

For the selected enhancer region, sgRNAs were designed using online tools (http://crispr.mit.edu/) supplied by Feng Zhang’s Lab. The sgRNAs and the reverse complementary sequences were synthesized and annealed, then cloned into the lentiGuide-Puro plasmid (Addgene, #52963) and linearized by BsmBI (Thermo, ER0451) following the protocol as described by Zhang et al. [56 (link), 57 (link)]. The sgRNA sequences are listed in Additional file 3: Table S5.
HEK 293T cells were transduced with lentivirus to stably express dCas9-KRAB [58 (link)]. Then the cells were seeded in a six-well plate and transfected with sgRNA plasmid using Lipofectamine® 2000 (Thermo, 11668019) at a density of 80%. After 72 h, cells were lysed by TRIzol Reagent (Thermo, 15596018).