Isogen reagent

Manufactured by Fujifilm

Sourced in Japan

Isogen reagent is a laboratory product manufactured by Fujifilm. It is a chemical reagent used in molecular biology and genetics research for the extraction and purification of RNA from biological samples.

Automatically generated - may contain errors

Lab products found in correlation

Quantitect reverse transcription kit, by Qiagen (2 mentions) Perfect real time, by Takara Bio (2 mentions) Sybr premix ex taq, by Takara Bio (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions) 7500 fast real time pcr system, by Thermo Fisher Scientific (2 mentions) High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions) Power sybr green pcr master mix, by Roche (1 mentions) Lightcycler, by Roche (1 mentions) T7 kit, by Takara Bio (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Cytotoxicity detection kitplus, by Roche (1 mentions) Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions) Sybr qpcr mix, by Toyobo (1 mentions) Thermal cycler tp800, by Takara Bio (1 mentions) Primescript rt master mix, by Takara Bio (1 mentions) Superscript 3 first strand synthesis system for rt pcr, by Thermo Fisher Scientific (1 mentions) Fugene reagent, by Roche (1 mentions) Anti flag f1804, by Merck Group (1 mentions) Taqman mirna assay, by Thermo Fisher Scientific (1 mentions)

13 protocols using isogen reagent

Quantifying Adipogenesis-Related Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from tissues using the Isogen reagent (Wako) and reverse transcribed using the QuantiTect Reverse Transcription Kit (Qiagen). PCR was performed using the Power SYBR Green PCR Master Mix (Roche) and LightCycler® (Roche). All expression levels were normalized to that of S18 mRNA.
Real-time RT-PCR primers used (5′ to 3′):

	Forward	Reverse
cd36	ttgtacctatactgtggctaaatgaga	cttgtgttttgaacatttctgctt
cidea	aaaccatgaccgaagtagcc	aggccagttgtgatgactaagac
cpt1a	gctgtcaaagataccgtgagc	tctccctccttcatcagtgg
elovl3	gaggcctctcatcctctggt	ttgccataaacttccacatcc
cpt1b	gcccatgtgctcctacca	ctctgagaggtgctgtagcaag
dio2	ctgcgctgtgtctggaac	ggagcatcttcacccagttt
fgf21	cacaccgcagtccagaaag	tgacacccaggatttgaatg
lipe (HSL)	agcgctggaggagtgtttt	ccgctctccagttgaacc
pnpla2 (ATGL)	tgaccatctgccttccaga	tgtaggtggcgcaagaca
slc27a1 (FATP1)	gacaagctggatcaggcaag	gaggccacagaggctgttc
slc27a3 (FATP3)	gagaacttgccaccgtatgc	ggtctcagtagtggccaaaga
slc27a4 (FATP4)	ggcagtgagatggcctca	cagagcagaagaggctgagtg
S18	tccagcacattttgcgagta	cagtgatggcgaaggctatt
ucp1	gatgtggtaaaaacaagattcatca	cgcagaaaagaagccacaa

Sekine S., Yao A., Hattori K., Sugawara S., Naguro I., Koike M., Uchiyama Y., Takeda K, & Ichijo H. (2016). The Ablation of Mitochondrial Protein Phosphatase Pgam5 Confers Resistance Against Metabolic Stress. EBioMedicine, 5, 82-92.

+ Open protocol

+ Expand

Silencing RORα in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNAs targeting different sequences in RORα (siRORa-258 and siRORa-1388) were generated using an in vitro transcription T7 kit (Takara Bio). siRNA against green fluorescent protein (siGFP) was used as a negative control. siRNA oligonucleotide sequences are listed in Supplementary Table S1. HepG2 cells were seeded in 24-well plates at 0.5 × 10⁵ cells/well and transfected using Lipofectamine 2000 (Life Technologies) with siRNA the following day. Cells were harvested 48 h after transfection, and total RNA was prepared using ISOGEN reagent (Wako Pure Chemical, Osaka, Japan). RORα and NCEH1 levels were quantified by qRT-PCR as described above. The effects of siRNA transfection on cell viability were estimated by measuring LDH activity using a Cytotoxicity Detection Kit PLUS (Roche), following the manufacturer’s protocol. Data were collected from at least three independent experiments.

Matsuoka H., Tokunaga R., Katayama M., Hosoda Y., Miya K., Sumi K., Ohishi A., Kamishikiryo J., Shima A, & Michihara A. (2020). Retinoic acid receptor-related orphan receptor α reduces lipid droplets by upregulating neutral cholesterol ester hydrolase 1 in macrophages. BMC Molecular and Cell Biology, 21, 32.

+ Open protocol

+ Expand

Quantitative Expression Analysis of Adipocyte Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 3T3-L1 adipocytes with the Isogen reagent (Wako Pure Chemical Inc., Osaka, Japan). Real-time reverse transcription–PCR was performed via the fluorescent dye SYBR Green I method using SYBR Premix Ex Taq and Perfect Real Time (Takara Bio, Shiga, Japan) with a StepOne Real-Time PCR system (Applied Biosystems, CA, USA). The primers used in this study were designed based on the GenBank™ information and synthesized by Invitrogen (Carlsbad, CA, USA). The PCR primers used for ACSL1, PPARγ, C/EBPα, FAS, and GAPDH are presented in Supplementary Table S2.

Nishikai-Shen T., Hosono-Fukao T., Ariga T., Hosono T, & Seki T. (2022). Cinnamon extract improves abnormalities in glucose tolerance by decreasing Acyl-CoA synthetase long-chain family 1 expression in adipocytes. Scientific Reports, 12, 12574.

+ Open protocol

+ Expand

Total RNA Isolation and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using ISOGEN reagent according to manufacturer's protocol (Fujifilm Wako, Osaka, Japan). cDNA was synthesized using the Superscript IV VILO Master Mix with ezDNase kit following the manufacturer's protocol (Invitrogen by Thermo Fisher Scientific, USA). Total RNA concentration of 1500 ng was used to synthesize cDNA.

Yap J.M., Ueda T., Kanemitsu Y., Takeda N., Fukumitsu K., Fukuda S., Uemura T., Tajiri T., Ohkubo H., Maeno K., Ito Y., Oguri T., Ugawa S, & Niimi A. (2021). AITC inhibits fibroblast-myofibroblast transition via TRPA1-independent MAPK and NRF2/HO-1 pathways and reverses corticosteroids insensitivity in human lung fibroblasts. Respiratory Research, 22, 51.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using ISOGEN reagent (Wako). Reverse transcription (RT) was performed using PrimeScript RT Master Mix (Takara, Shiga, Japan) according to the manufacturer’s instructions. cDNAs were quantified by real-time PCR using SYBR qPCR mix (Toyobo, Osaka, Japan) and a Thermal Cycler TP800 (Takara). RT primers were as follows: AR (s) 5′-ATGGTGAGCAGAGTGCCCTA-3′, (as) 5′-TCTGGGGTGGAAAGTAATAGTCAA-3′; CNPY2 (s) 5′- GACCATGCCCTGCACATATC-3′, (as) 5′- TAAAAGGCATTGCCACCATT-3′; GAPDH (s) 5′-GCACCGTCAAGGCTGAGAAC-3′, (as) 5′-TGGTGAAGACGCCAGTGGA-3′; KLK3 (s) 5′- TCTGCGGCGGTGTTCTG-3’, (as) 5′- GCCGACCCAGCAAGATCA-3′; TMPRSS2 (s) 5′- GGACAGTGTGCACCTCAAAGAC-3′, (as) 5′- TCCCACGAGGAAGGTCCC-3′; NKX3-1 (s) 5′- CCCAGTCCACTGAGCAAGCA-3′, (as) 5′- GGGACCCATTATAGGCAATAAACAC-3′.

Ito S., Ueno A., Ueda T., Nakagawa H., Taniguchi H., Kayukawa N., Fujihara-Iwata A., Hongo F., Okihara K, & Ukimura O. (2018). CNPY2 inhibits MYLIP-mediated AR protein degradation in prostate cancer cells. Oncotarget, 9(25), 17645-17655.

+ Open protocol

+ Expand

Prm1, Prm2, and Tnp1 Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from the cauda epididymis and vas deferens of the Prm1^+/+ and Prm1^+/− mice using ISOGEN reagent (Wako, Tokyo, Japan). Total RNA was reverse transcribed using a SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen). Amplifications were performed for 24 cycles. The primers used were as follows: Prm1 forward primer 5′-ATGGCCAGATACCGATGCTG-3′; Prm1 reverse primer 5′-CTAGTATTTTTTACACCTTATGG-3′; Prm2 forward primer 5′-ATGGTTCGCTACCGAATGAGG-3′; Prm2 reverse primer 5′-TTAGTGATGGTGCCTCCTACA-3′; Tnp1 forward primer 5′-ATGTCGACCAGCCGCAAGC-3′; Tnp1 reverse primer 5′-TCACAAGTGGGATCGGTAATTG-3′; GAPDH (housekeeping gene) forward primer 5′-TGTCATCAACGGGAAGCCCA-3′; and GAPDH reverse primer 5′-TTGTCATGGATGACCTTGGC-3′.

Takeda N., Yoshinaga K., Furushima K., Takamune K., Li Z., Abe S.I., Aizawa S.I, & Yamamura K.I. (2016). Viable offspring obtained from Prm1-deficient sperm in mice. Scientific Reports, 6, 27409.

+ Open protocol

+ Expand

PARN and CUGBP1 Interaction in miRNA Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cDNAs encoding human PARN and C-terminally Flag-tagged human CUGBP1 were cloned into the pDEST12.2 vector (Invitrogen). Huh7 cells cultured in 10-cm dishes were transfected with 6 μg of each vector using FuGENE reagent (Roche). As a control, a mock-transfection was performed without plasmid. At 72 h post-transfection, the cells were treated with ISOGEN reagent (Wako) to isolate total RNA. The steady-state level of each mature miRNA was measured using TaqMan miRNA assays (Applied Biosystems), according to the manufacturer's instructions. The expression level of CUGBP1 was determined by immunoblotting using anti-CUGBP1 (RN002MW; MBL) and anti-Flag (F1804; Sigma) antibodies. The expression levels of PARN and ACTB (control) were determined using anti-PARN (3899; Cell Signaling Technology) and anti-ACTB (SAB1403520; Sigma) antibodies, respectively. Ago2 was detected by immunoblotting using an anti-Ago2 antibody (4G8; Wako).

Katoh T., Hojo H, & Suzuki T. (2015). Destabilization of microRNAs in human cells by 3′ deadenylation mediated by PARN and CUGBP1. Nucleic Acids Research, 43(15), 7521-7534.

+ Open protocol

+ Expand

RNA Extraction and RT-PCR for ALSV Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from S. latifolia leaves by using the ISOGEN reagent (FUJIFILM Wako Chemicals, Osaka, Japan) or TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). One-step RT-PCR was performed by using the SuperScript III One-Step RT-PCR System with Platinum Taq (Thermo Fisher Scientific). The primer set R2ALS1363(+) and R2ALS1551(−) was used for detecting ALSV (Figure 1). The primer set ALSR2-1213(+) and ALSR2-1484(−), which was designed to flank the multiple cloning site of the ALSV vector, was used for detecting ALSV in inoculated plants, and for checking whether the infected vector retained the insert. The reaction volume was 10 µL, and the thermal cycling conditions were 50 °C for 30 min for reverse transcription, 94 °C for 2 min to activate the DNA polymerase; followed by 40 cycles of denaturation at 94 °C for 15 s, annealing at 55 °C for 30 s, and extension at 68 °C for 1 min; with a final extension at 68 °C for 7 min.

Fujita N., Kazama Y., Yamagishi N., Watanabe K., Ando S., Tsuji H., Kawano S., Yoshikawa N, & Komatsu K. (2019). Development of the VIGS System in the Dioecious Plant Silene latifolia. International Journal of Molecular Sciences, 20(5), 1031.

+ Open protocol

+ Expand

Real-Time PCR Analysis of Gene Expression under Mild Heat Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols

The NSCs/NPCs were allowed to grow in PM for the indicated times and collected. Total RNA was isolated using Isogen reagent (Wako), reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen), and amplified using the ABI prism 7000 sequence detection system (Applied Biosystems). Real-time polymerase chain reaction was carried out with the QuantiTect SYBR Green PCR Kit (Qiagen). The primer sequences are listed in S1 Table. The PCR conditions were as follows: initial activation at 95°C for 15 min, then 40 amplification cycles of denaturation at 94°C for 15 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. Relative quantification was performed using the 2^−ΔΔCt method with 18S rRNA as the endogenous control. Relative gene expression is presented as a ratio of target gene expression under mild heat exposure to expression at the control temperature.

Hossain M.E., Matsuzaki K., Katakura M., Sugimoto N., Mamun A.A., Islam R., Hashimoto M, & Shido O. (2017). Direct exposure to mild heat promotes proliferation and neuronal differentiation of neural stem/progenitor cells in vitro. PLoS ONE, 12(12), e0190356.

+ Open protocol

+ Expand

Gene Expression Analysis of Mouse Desmosomal Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from mouse tissue using Isogen reagent (Wako Pure Chemical Industries) and from 3D-keratinocytes and HEKn cells using an RNeasy Mini Kit (Qiagen, Hilden, Germany), then reverse-transcribed using a High-Capacity RNA-to-cDNA kit (Thermo Fisher Scientific). Quantitative real time polymerase chain reaction (RT-qPCR) was performed using Fast SYBR Green Master Mix (Thermo Fisher Scientific) or TaqMan Fast Universal PCR Master Mix (Thermo Fisher Scientific) on a 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). The following mouse genes were analyzed using TaqMan Gene Expression Assays (Thermo Fisher Scientific): Dsg1a (Mm00809994_s1), Dsg1b (Mm00839130_mH), and Dsg1c (Mm00725121_g1). Details of the primer pairs used with Fast SYBR Green Master Mix are given in S2 Table.

Aoki M, & Murase T. (2019). Obesity-associated insulin resistance adversely affects skin function. PLoS ONE, 14(10), e0223528.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!