The mRNA extraction executed as formerly described by Beheshti et al. (2020) (link) and mRNA expression measurement was performed for the three groups (Beheshti et al., 2020 (link)). Total RNA was extracted from the hippocampus samples using RNX-PLUS reagent (SinaClon, Iran). cDNA was synthesized according to the manufacturer’s protocol with a cDNA synthesis kit (Takara, Japan). Real-time PCR assay was performed by StepOnePlus™ Real-Time PCR System. The sequences of Real-time PCR primers were as follows: 5′- AGGGCCTATGATGGACTTTCTG-3′, and 5′-TCCGTGGCCATCTTCACATC-3′ for mice Synaptophysin, 5′-CCTCCACTCTTGCTACCTGC-3′, R-5′-TCCTCTGCATCTCCTCCAGT-3′) for mice SNAP-25, 5′-CGGCAAACTGACTGTCATTC-3′ and 5′-GCC CCA GTG CTG TTG TAA CCA-3′ for mice Synaptotagmin 1, and 5′-CAGGGCTGCCTTCTCTTGTG-3′, and 5′-GATGGTGATGGGTTTCCCGT-3′ for mice Glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Relative genomic expression was calculated by the 2−ΔΔCT method. The mRNA levels were normalized to that of GAPDH (Beheshti et al., 2020 (link)).
Rnx plus reagent
Manufactured by Sinaclon
RNX-Plus reagent is a laboratory product designed for the isolation and purification of RNA from various biological samples. It is a solution that facilitates the extraction and separation of RNA molecules from cellular components.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Cdna synthesis kit, by Takara Bio (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
1 1 3 3 tetraethoxypropane, by Merck Group (1 mentions)
2 thiobarbituric acid, by Merck Group (1 mentions)
Ferric chloride fecl3 6h2o, by Merck Group (1 mentions)
Streptozotocin (stz), by Merck Group (1 mentions)
2 4 6 tripyridyl s triazine, by Merck Group (1 mentions)
Sod kit, by ZellBio (1 mentions)
Sodium acetate, by Merck Group (1 mentions)
Rotor gene rg 300, by Qiagen (1 mentions)
Ficoll paque solution, by Cytiva (1 mentions)
Rnase free dnase, by Thermo Fisher Scientific (1 mentions)
Primescript first strand cdna synthesis kit, by Takara Bio (1 mentions)
T100 thermal cycler, by Bio-Rad (1 mentions)
Steponeplus, by Thermo Fisher Scientific (1 mentions)
13 protocols using rnx plus reagent
1
Quantifying Synaptic Gene Expression in Hippocampus
2
Plasma Lipid and miRNA Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Venous blood was collected in EDTA tubes after a 12-h overnight fast. Plasma were separated immediately afterward in a refrigerated centrifuge to avoid any loss of analytics. Modular analyzer DDPPII Hitachi (Roche, Switzerland) was used for lipid variables and colorimetric enzymatic methods for assessing total cholesterol (TC), high-density lipoprotein (HDL-C), and low-density lipoprotein (LDL-C) and triglyceride (TG) and nephelometry was used for measuring Apolipoproteins AI (apoAI) and B (apo B). Extraction of RNA and cDNA synthesis Anticoagulant EDTA tubes were used for blood samples collection and peripheral blood mononuclear cells (PBMCs) were obtained with centrifugation.RNA was extracted using RNX™-plus reagent (SinaClon, Iran). The cDNA was synthesized by the advanced miRNA cDNA Synthesis Kit (TaqMan). RT-qPCR with the SYBR green was used to evaluate the expression levels of selected miRNA, the reaction was set as 5 min at 95 °C, 10 s at 95 °C for 45 cycles, and 5 min at 95 °C, with specific forward primer and the universal adaptor reverse primer. The relative expression was calculated with 2 -∆∆Ct method, and U6 was used as internal controls, respectively [20] .
3
Diabetic Oxidative Stress Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Coenzyme Q10 was obtained from Cayman medical company (Ann Arbor, MI, USA) and streptozotocin (STZ) was obtained from sigma (St. Louis, MO, USA). RNX-plus reagent was purchased from Sinaclon company (Tehran, I.R. Iran) and reagents for complementary DNA (cDNA) synthesis were acquired from Takara (Kyoto, Japan). RT-PCR SYBR green I master mix was obtained from Yekta Tajhiz Azma Co. (Tehran, I.R. Iran). SOD kit was procured from Zell bio GmbH Company (Germany). 2,4,6-Tripyridyl-s-triazine, 1,1,3,3-tetraethoxy propane, were obtained from Sigma (St. Louis, MO, USA). 2-thiobarbituric acid, ferric chloride (FeCl3, 6H2O), and sodium acetate were provided by Merck company (Darmstadt, Germany).
4
Quantification of adeB Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To examine adeB gene expression, isolated were treated with MIC and sub MIC of CCCP. RNA from each isolate was extracted using RNX- Plus reagent (SinaClon BioScience; Iran) solution according to the manufacturer’s instructions. The Thermo Scientific™ NanoDrop 2000 calculated the concentration and purification of each RNA sample. cDNAs were synthesized using the Revert Aid first-strand cDNA synthesis kit (Yektatajhiz; Iran) with 1.5 μg of RNA at a 20 μL reaction rate. The Real-Time PCR was conducted on a Rotor-Gene RG-300 (Corbett Research, Sydney, AU) and SYBR Green Real-time PCR Master Mix kit (Yektatajhiz; Iran) to show the quantification of mRNA. A paired primer was applied for the amplification of adeB gene (primer sequence: F: 5'-AACGGACGACCATCTTTGAG-3'; R: 5'-CAGTTGTTCCATTTCACGCA-3'). Thermal cycling continued the denaturation process at 95 °C for 5 min for the first denaturation stage at 95 °C for 5 min and then 38 cycles at 95 °C for 15 s, 61 °C for 20 and 72 for 25 s. The amplification specificity of adeB gene expression was confirmed by the melting curve. adeB gene expression was standardized against 16sRNA as an internal control, and relative quantification (2−ΔΔCq) revealed the fold changes of expression.
5
Isolation and Purification of PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The isolation of Peripheral Blood Mononuclear Cells (PBMCs) was carried out on Ficoll–Paque solution (Amersham Biosciences AB Björkgatan 30, SE-751 84 Uppsala, Sweden) through density gradient centrifugation following the standard procedure of the manufacturer. According to the manufacturer’s instructions, total RNA was extracted from PBMCs by RNX™-Plus reagent (SinaClon, Tehran, Iran). The removal of genomic DNA was done by treating the extracted RNA with DNase I (Fermentas, Lithuania) at 37°C for 15 min, followed by verification through spectrophotometry and 1% agarose gel electrophoresis.
6
Quantitative PCR of Inflammatory Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in RNXplus Reagent (Sinaclon, Iran), and the total RNA was extracted according to the manufacturer’s instructions. The quality, quantity, and concentration of extracted RNA were evaluated by electrophoresis and Nano-Drop. RNA was reverse transcribed to cDNA by Synthesis Kit (Thermo Scientific, USA). Quantitative PCR was executed using the MIC qPCR–Magnetic Induction Cycler and RT-PCR kit with SYBR Green (Ampliqon, UK) according to the manufacturer’s instructions. The condition of PCR was as follows: 5 min enzyme activation at 95°C, 40 cycles of 95°C for 30 s, annealing temperature of primers for 20 s and 72°C for 40 s, so for Tnf-α, the forward primer: 5′GCTCCCTCTCATCAGTTCC3′ and the reverse primer: 5′TTGGTGGTTTGCTACGAC3′ , annealing Tm 55°C; for Nos2, the forward primer: 5′GAGATGTTGAACTACGTCCTATC-3′ , the reverse primer: 5′CCATGACCTTCCGCATTAG-3′ , annealing Tm 60°C and for Nf-кb, the forward primer: 5′GCTCAAGATCTGCCGAGTAAA-3′ and the revers primer: 5′GTCCCGTGAAATACACCTCAA-3′ , annealing Tm 62°C.Moreover, a reference gene Gapdh was amplified by the forward primer: 5′CTCATGACCACAGTCCATGC3′ and the reverse primer: 5′TTCAGCTCTGGGATGACCT3′ .
7
PBMC Isolation and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three milliliters of whole blood were taken and collected in the anti-coagulant EDTA tubes from each participant. Peripheral Blood Mononuclear Cells (PBMCs) were isolated by density gradient centrifugation on Ficoll-Paque solution (lympholyte, Cedarlane, Sweden) according to manufacturer's instructions as described.
Total RNA was extracted from PBMCs by RNX™-Plus reagent (SinaClon, Iran) based on the manufacturer's instructions. Isolated RNAs were treated with DNase I (Fermentas, Lithuania) for 15 min at 37° C to remove any genomic DNA contamination. RNAs quality and quantity were verified by 1% agarose gel electrophoresis and spectrophotometry, respectively.
Total RNA was extracted from PBMCs by RNX™-Plus reagent (SinaClon, Iran) based on the manufacturer's instructions. Isolated RNAs were treated with DNase I (Fermentas, Lithuania) for 15 min at 37° C to remove any genomic DNA contamination. RNAs quality and quantity were verified by 1% agarose gel electrophoresis and spectrophotometry, respectively.
8
Hippocampal mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA extraction was performed as formerly has been described by Gheysarzadeh et al. (2019) (link) and mRNA expression measurement was done for the three groups (six rats in each group) (Gheysarzadeh et al., 2019 (link)). Total RNA was extracted from the hippocampus samples using RNX-PLUS reagent (SinaClon, Iran). cDNA was synthesized according to the manufacturer’s protocol with a cDNA synthesis kit (Takara, Japan). Real-time PCR assay was performed by StepOnePlus™ Real-Time PCR System. The sequences of Real-time PCR primers were as follows: 5′-GAGGAAGGTCTGAACCGCTCAT-3′, and 5′- CGTTCTCGGTAGTCTGACTGAG-3′ for mice syntaxin1A, 5′- AGGGCCTATGATGGACTTTCTG-3′, and 5′-TCCGTGGCCA TCTTCACATC-3′ for mice Synaptophysin, 5′-CGGCAAA CTGACTGTCATTC-3′ and 5′-GCC CCA GTG CTG TTG TAA CCA-3′ for mice Synaptotagmin 1, and 5′-CAGGG CTGCCTTCTCTTGTG-3′, and 5′-GATGGTGATGGGTTTC CCGT-3′ for mice Glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Relative genomic expression was calculated by the 2–Δ Δ Ct method. The mRNA levels were normalized to that of GAPDH (Gheysarzadeh et al., 2019 (link)).
9
Real-time PCR Analysis of EMT Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 48 h of crocin treatment, the expression of desired genes was assessed by real-time PCR (qRT-PCR). Total RNA extraction was performed using RNX-plus reagent (SinaClon) following the manufacturer’s protocol. cDNA synthesis was carried out using the Pars toos RT Reagent kit with 1 µg of total RNA (Pars toos).
qRT-PCR was performed in triplicate for each sample using specific primers for β-catenin, E-cadherin, Vimentin, Snail, and Zeb-1 (Table1 ) in a 20 μl reaction mixture containing 1 μL of 0.5 mM primer, 10 μl of SYBR Green master mix, 5 μl of DW, and 4 μl of cDNA in a PCR microtube. The amplification reaction was carried out using the Rotor gene 6000 system (Corrbet).
The fold change in expression level of each mRNA sample was normalized against β-actin mRNA and quantified using the comparative 2-ΔΔCt method.
qRT-PCR was performed in triplicate for each sample using specific primers for β-catenin, E-cadherin, Vimentin, Snail, and Zeb-1 (Table
The fold change in expression level of each mRNA sample was normalized against β-actin mRNA and quantified using the comparative 2-ΔΔCt method.
10
RNA Extraction and qRT-PCR for tst Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNX-Plus reagent (SinaClon, Iran) was used to isolate total RNA, according to the
manufacturer’s protocol. RNA was quantified, and the concentration and purity were
measured based on absorption rate of 260/280 nm using a Nanodrop spectrophotometer
(Nanodrop 2000, Thermo Scientific, USA). Total RNA samples were treated with RNase-free
DNase (Thermo Scientific, USA) before quantitative reverse transcription polymerase chain
reaction (qRT-PCR). A RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA)
was used to synthesize complementary DNA (cDNA) from total RNA. A PCR test was applied
using tst specific primers on cDNA to confirm tst gene
expression after lipofection. Primer sequences were as follows:
tst-
Sense: 5´-GCACAAACGACAACATTAAGGACC-3ˊ
Antisense: 5´-TTGTCCGCTTTGTGTTGAGGTC-3ˊ.
manufacturer’s protocol. RNA was quantified, and the concentration and purity were
measured based on absorption rate of 260/280 nm using a Nanodrop spectrophotometer
(Nanodrop 2000, Thermo Scientific, USA). Total RNA samples were treated with RNase-free
DNase (Thermo Scientific, USA) before quantitative reverse transcription polymerase chain
reaction (qRT-PCR). A RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA)
was used to synthesize complementary DNA (cDNA) from total RNA. A PCR test was applied
using tst specific primers on cDNA to confirm tst gene
expression after lipofection. Primer sequences were as follows:
tst-
Sense: 5´-GCACAAACGACAACATTAAGGACC-3ˊ
Antisense: 5´-TTGTCCGCTTTGTGTTGAGGTC-3ˊ.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!