Lc480 cycler

Manufactured by Roche

Sourced in Germany

The LC480 cycler is a real-time PCR instrument designed for quantitative and qualitative nucleic acid analysis. It features a thermal block that can accommodate up to 96 samples simultaneously. The LC480 cycler provides precise temperature control and detection capabilities for accurate and reproducible results.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

LC480 (158 citations) LC480 Light Cycler (79 citations) Light Cycler LC480 system (16 citations) LC480-II thermal cycler (7 citations) LC480 qPCR cycler (3 citations) Light-Cycler LC480 real-time PCR system (3 citations) Syber green on LC480 light cycler (2 citations) LC480-II cycler (2 citations) LC480 thermal cycler (2 citations) LC480 Light Cycler II (2 citations)

14 protocols using lc480 cycler

Quantifying Muscle Gene Expression via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from TA muscles was isolated with QIAzol Lysis Reagent (Qiagen) and quantified with Nanodrop. M-MLV Reverse Transcriptase (Promega) was used to synthesize cDNAs from 1 µg total RNA following the manufacturer’s instructions. RT-qPCR reactions were performed with SYBR Green in 384-well plates using the Roche LC-480 cycler (Roche Applied Science). All data were normalized to L7 expression. Primer sequences are listed in Table 1.Table 1

Primers used for qPCR.

Gene	Species	Forward primer	Reverse primer
Sesn1	Mouse	GTCTGGATAACATCACATTAG	CCAGGTAGGAACACTGATGC
Sesn1	Human	CAGCATTGGAAAACATTAGGCAA	CCGAAGACTCGGTATTTGAAAGC
Sesn2	Mouse	TAGCCTGCAGCCTCACCTAT	TATCTGATGCCAAAGACGCA
Sesn3	Mouse	CATGCGTTTCCTCACTCAGA	GGCAAAGTCTTCGTACCCAA
Fbxo32	Mouse	AAGGCTGTTGGAGCTGATAGCA	CACCCACATGTTAATGTTGCCC
Trim63	Mouse	TGCCTGGAGATGTTTACCAAGC	AAACGACCTCCAGACATGGACA
Ctsl	Mouse	GTGGACTGTTCTCACGCTCAAG	TCCGTCCTTCGCTTCATAGG
FoxO1	Mouse	CTGGGTGTCAGGCTAAGAGT	GGGGTGAAGGGCATCTTT
FoxO3	Mouse	CTGGGGGAACCTGTCCTATG	TCATTCTGAACGCGCATGAAG
FoxO4	Mouse	CTTCCTCGACCAGACCTCG	ACAGGATCGGTTCGGAGTGT
Atg7	Mouse	TCTGGGAAGCCATAAAGTCAGG	GCGAAGGTCAGGAGCAGAA
L7	Mouse	GAAGCTCATCTATGAGAAGGC	AAGACGAAGGAGCTGCAGAAC

Segalés J., Perdiguero E., Serrano A.L., Sousa-Victor P., Ortet L., Jardí M., Budanov A.V., Garcia-Prat L., Sandri M., Thomson D.M., Karin M., Hee Lee J, & Muñoz-Cánoves P. (2020). Sestrin prevents atrophy of disused and aging muscles by integrating anabolic and catabolic signals. Nature Communications, 11, 189.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis in Baboons

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The technique was applied as described previously (Zabirnyk et al., 2010 (link)). Total RNA was isolated using RNeasy Kit (Qiagen, Valencia, CA) and complementary DNA was synthesized using SuperScriptTM III First-Strand Synthesis SuperMix (Invitrogen, Carlsbad, CA). Expression of the gene of interest was measured by TaqMan quantitative PCR using Roche LC480 cycler (Roche Diagnostics Corporation, Indianapolis, IN). TaqMan probes labeled with a specific fluorophore and primers for genes of interest were both designed using the www.universalprobelibrary.com website against the cDNA sequences of Papio anubis and bought from IDT (IDT, Newark, NJ). The cDNA was pre-amplified using TaqMan PreAmp Master Mix Kit (Applied Biosystems, Foster City, CA). Kappa probe fast qPCR Kit Master mix (2x) Universal (Kappa Biosystems, Boston, MA) was used to run the Real-Time PCR. Each primer pair was validated for an efficiency of around 100%. The primer pairs and probes were as follows:
The samples were run in duplicate for both target and reference (beta-actin) genes. The results were analyzed using Light Cycler 480 software (Roche Diagnostics Corporation, Indianapolis, IN).

Seleverstov O., Tobiasz A., Jackson J.S., Sullivan R., Ma D., Sullivan J.P., Davison S., Akkhawattanangkul Y., Tate D.L., Costello T., Barnett S., Li W., Mari G., Dopico A.M, & Bukiya A.N. (2017). Maternal alcohol exposure during mid-pregnancy dilates fetal cerebral arteries via endocannabinoid receptors. Alcohol (Fayetteville, N.Y.), 61, 51-61.

+ Open protocol

+ Expand

RNA Isolation and RT-qPCR of Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from proliferating and differentiating myoblasts was isolated with TriPure Isolation Reagent and quantified with Nanodrop. M-MLV reverse transcriptase (Promega) was used to synthesize cDNAs from the total RNA (1 μg) following the manufacturer’s recommendations. RT-qPCR reactions were performed with SYBR Green in 384-well plates using the Roche LC-480 cycler (Roche Applied Science). The mRNA expression of target genes was normalized to L7 expression, and the data are represented as the mean ± SD of three independent experiments. Primer sequences are listed in Additional file 1: Table S2.

Segalés J., Islam A.B., Kumar R., Liu Q.C., Sousa-Victor P., Dilworth F.J., Ballestar E., Perdiguero E, & Muñoz-Cánoves P. (2016). Chromatin-wide and transcriptome profiling integration uncovers p38α MAPK as a global regulator of skeletal muscle differentiation. Skeletal Muscle, 6, 9.

+ Open protocol

+ Expand

Quantification of AhR-Regulated Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from MC38 and Hepa1c1c7 cells was extracted using Direct-zol Total RNA extraction kit (Zymo Research). RNA quantitation was done using a QIAxpert (Qiagen). 1 µg of RNA per reaction was used to set up the cDNA reaction. cDNA was prepared immediately from RNA using the SuperScript III first strand synthesis super mix for qRT-PCR (Thermo Fisher Scientific) following manufacturer’s instructions. The prepared cDNA was immediately used to set up the RT-PCR reaction. 2 µl of cDNA was used per sample to set the RT-PCR reaction with three technical replicates. Real-time PCR was done using Sso advanced SYBR green master mix (Bio-Rad). The samples were run on the LC480 cycler (Roche). The housekeeping gene gapdh was used as the standard. Fold induction was calculated using the 2^−∆∆C^_T method.26 (link) All the primers for the assay were ordered from Integrated DNA Technologies. The primer sequences are shown in Table 1.Table 1

PCR primer sequences used for SYBR green qPCR analysis

Gene	Forward Primer	Reverse Primer
cyp1a1	CAATGAGTTTGGGGAGGTTACTG	CCCTTCTCAAATGTCCTGTAGTG
ugt1a	GCTTCTTCCGTACCTTCTGTTG	GCTGCTGAATAACTCCAAGCAT
nqo	AGGATGGGAGGTACTCGAATC	TGCTAGAGATGACTCGGAAGG
ahrr	ACATACGCCGGTAGGAAGAGA	GGTCCAGCTCTGTATTGAGGC
cyp1a2	AGTACATCTCCTTAGCCCCAG	GGTCCGGGTGGATTCTTCAG
cyp1b1	CACCAGCCTTAGTGCAGACAG	GAGGACCACGGTTTCCGTTG
gapdh	TCTCCCTCACAATTTCCATCCCAG	GGGTGCAGCGAACTTTATTGATGG

Yakkundi P., Gonsalves E., Galou-Lameyer M., Selby M.J, & Chan W.K. (2019). Aryl hydrocarbon receptor acts as a tumor suppressor in a syngeneic MC38 colon carcinoma tumor model. Hypoxia, 7, 1-16.

+ Open protocol

+ Expand

Quantitative Analysis of Gene and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Trizol^® reagent (Invitrogen) was used to extract the total RNA from cells and quantified using a multifunctional microplate reader. Bestar™ qPCR RT Kit (DBI, Ludwigshafen) was used for reverse transcription, and then cDNAs were used as templates for the qPCR assay (Promega, Madison) in a Roche LC480 cycler (Roche, Mannheim). β-Actin served as the mRNA internal control. Changes in relative mRNA expression were calculated by the 2^-ΔΔct method. All the mRNA primers are listed in Supplemental Table ST1.
The miRNA was quantified according to a miDETECT A Track™ qRT-PCR Starter Kit (Ribobio, Guangzhou). Briefly, after poly (A) tailing, total RNA (1 μg) was used for cDNA synthesis to do the qPCR assay. The 2^-ΔΔct method was used to calculate the expression of 8 microRNAs, and U6 served as an internal control. The miRNA primer sequences were purchased from RiboBio (Guangzhou, China).

Wang T., Mo L., Ou J., Fang Q., Wu H., Wu Y, & Nandakumar K.S. (2022). Proteus mirabilis Vesicles Induce Mitochondrial Apoptosis by Regulating miR96-5p/Abca1 to Inhibit Osteoclastogenesis and Bone Loss. Frontiers in Immunology, 13, 833040.

+ Open protocol

+ Expand

Detecting B. cereus Group by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR was performed as previously described^{32 (link)}, using the primer set specifically targeting a region in the 16S rDNA of the B. cereus group. Detection of the amplification product was performed using SYBRgreen and a LC 480-Cycler (Roche).

Fertey J., Thoma M., Beckmann J., Bayer L., Finkensieper J., Reißhauer S., Berneck B.S., Issmail L., Schönfelder J., Casado J.P., Poremba A., Rögner F.H., Standfest B., Makert G.R., Walcher L., Kistenmacher A.K., Fricke S., Grunwald T, & Ulbert S. (2020). Automated application of low energy electron irradiation enables inactivation of pathogen- and cell-containing liquids in biomedical research and production facilities. Scientific Reports, 10, 12786.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from DiFi cells using the RNeasy mini Kit (Qiagen, Hilden, Germany) with a DNAse digestion step. Total RNA (1 μg) was reverse-transcribed using the SuperScript III reverse transcriptase (Invitrogen, Life Technologies). Real-time quantitative PCR (qPCR) was performed using the LC480 cycler (Roche Diagnostics, Meylan, France) according to the manufacturer's instruction. The amplification specificity was verified by melting curve analysis. Real-time PCR values were determined by reference to a standard curve that was generated by real-time PCR amplification of a serially diluted cDNA sample using primers specific for p27, BIM and 28s. The quantification data were normalised to the amplification data for the reference gene 28s.

Marzi L., Combes E., Vié N., Ayrolles-Torro A., Tosi D., Desigaud D., Perez-Gracia E., Larbouret C., Montagut C., Iglesias M., Jarlier M., Denis V., Linares L.K., Lam E.W., Martineau P., Del Rio M, & Gongora C. (2016). FOXO3a and the MAPK p38 are activated by cetuximab to induce cell death and inhibit cell proliferation and their expression predicts cetuximab efficacy in colorectal cancer. British Journal of Cancer, 115(10), 1223-1233.

+ Open protocol

+ Expand

Endothelial Marker Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression of endothelial marker genes (CD34, CD31/PECAM1, and VEGFR2) was assessed using qRT-PCR. GAPDH was used as the housekeeping gene. RNA was extracted using the TRIzol reagent kit (Invitrogen) according to the manufacturer's instructions. One microgram of RNA from each sample was used for reverse transcription using the ABI High-Capacity RNA-to-cDNA kit (Applied Bioscience) according to the supplier's instructions. cDNA was then amplified using ABI TaqMan primers (GAPDH: Hs99999905-m1, CD34: Hs00990732-m1, CD31/PECAM1: Hs01065279-m1, VEGFR2: Hs00911700-m1) in a 20 μL reaction mix in 96-well plates (Roche). Amplification was performed using a Roche LC480 cycler.
The results were analyzed using the 2^−ΔΔct method^{29 (link)} where ct values at each time point were normalized to the housekeeping gene in the same sample and further normalized to ct values of control samples (cultured under basal conditions) at the corresponding time points. Results were then expressed as log mean 2^−ΔΔct±standard deviation (SD).

El-Gendy R., Kirkham J., Newby P.J., Mohanram Y., Boccaccini A.R, & Yang X.B. (2015). Investigating the Vascularization of Tissue-Engineered Bone Constructs Using Dental Pulp Cells and 45S5 Bioglass® Scaffolds. Tissue Engineering. Part A, 21(13-14), 2034-2043.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction and qRT-PCR were performed as reported (Cao et al., 2013 (link)). Briefly cells or freshly harvested brain tissues were collected in Trizol reagent (Invitrogen). Tissues were homogenized with a microtube homogenizer (Fisher Scientific Limited) and RNA was extracted according to manufacturer’s instructions. cDNA synthesis was carried out using Superscript III First-strand synthesis kit (Invitrogen, Cat # 18080-051) according to manufacturer’s instructions. PCR reactions were set up using the SYBR Green PCR Master Mix Detection System (Biorad; Cat # 1708882). Primers sequences are shown in KEY RESOURCES TABLE. Quantitative Real-time PCR was carried out in triplicates in a Roche LC480 cycler and Ct values were outputted for quantification. The raw data generated from triplicates were normalized by the levels of Gapdh (mouse) or β-actin (human) mRNAs from the same samples. Data analysis was done using the ΔΔct method.

Pathak S.S., Liu D., Li T., de Zavalia N., Zhu L., Li J., Karthikeyan R., Alain T., Liu A.C., Storch K.F., Kaufman R.J., Jin V.X., Amir S., Sonenberg N, & Cao R. (2019). The eIF2α kinase GCN2 modulates period and rhythmicity of the circadian clock by translational control of Atf4. Neuron, 104(4), 724-735.e6.

+ Open protocol

+ Expand

Quantitative Analysis of Cerebrovascular Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from frozen middle cerebral artery and their branches of baboon mothers and near-term fetuses by using QIAcube (Qiagen, Hilden, Germany) at UTHSC Molecular Resource Center on a fee-for-service basis. Complementary DNA was synthesized from isolated RNA by The High capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA) according to manufacturer’s instructions. The cDNA was pre-amplified using TaqMan PreAmp master mix kit (Applied Biosystems, Foster City, CA) by using same amount of total cDNA in each sample. Kappa Probe Fast qPCR master mix(2x) was used to run PCR and expression of gene of interest was measured by TaqMan quantitative PCR using LC480 cycler (Roche Life Science, Penzberg, Germany) at UTHSC MRC facility on a fee-for-service basis. TaqMan probes and primers for genes encoding CB1, CB2, and actin are specified in our recent publication [8 (link)].

Simakova M., Tobiasz A., Sullivan R.D., Bisen S., Duncan J., Sullivan J.P., Davison S., Tate D.L., Barnett S., Mari G., Dopico A.M, & Bukiya A.N. (2019). Gestational Age-Dependent Interplay between Endocannabinoid Receptors and Alcohol in Fetal Cerebral Arteries. Journal of drug and alcohol research, 8, 236068.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!