Mir 124 mimic

The siRNAs targeting IL-6R or STAT3 were purchased from RiBoBio Co (Guangzhou, China) and transfected into MGC803 cells using the Lipofectamine^® 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Con-mimic, miR-124-mimic, anti-con, and anti-miR-124 were also synthesized by RiBoBio. Briefly, cells were seeded into six-well plates at a density of 1 × 10⁵ cells per well for 24 h and then were transfected with 50 nM anti-miR-124 or 20 nM miR-124-mimic for 12 h. After transfections, cells were cultured in fresh RPMI-1640 medium supplemented with 10% FBS (Gibco-BRL) for another 24 h before using for other experiments.

Based on the sequence of miR-124 in miRBase database (MIMAT0000422), miR-124 mimic (dsRNA oligonucleotides), negative control mimic (miR-124 nc) and miR-124 inhibitors (single- stranded chemically modified oligonucleotides) were synthesized in Ribobio Inc (Guangzhou, China). The oligonucleotides were transfected into A549 cells using Lipofectamine 2000 reagents per manufacturer's instructions (Invitrogen, United States). For cells cultured in a 6-well dish, 20 µM of miR-124 mimic, miR-124 nc or miR-124 inhibitor was transfected. The transfection mixture was removed and 2 ml/well of fresh medium was added at 6 h post-transfection, the transfected cells were cultured for an additional 24 h before they were harvested for analysis. Cells were transfected with pcDNA3.1 plasmid to serve as transfection controls for each experiment.

Chemically synthesized miR-124 mimics and the scramble negative controls were purchased from RiboBio (Shanghai, China). Putative binding sites between miR-124 and 3’UTR of RhoA were predicted using TargetScan 6.2. Wild type or mutant (without miR-124 binding site) human RhoA 3'UTR sequences with flanking SacI and XhoI restriction enzyme digestion sites were chemically synthesized. Then the wild type and mutant sequences were inserted between SacI and XhoI sites of pGL-3 promoter vector respectively. The recombinant plasmids were named as pGL3-RhoA-WT and pGL3-RhoA-MUT respectively. To assess the influence of putative miR-124 binding site on luciferase expression, HEK 293T cells were co-transfected with 200ng recombinant plasmids, 20ng phRL-TK plasmid carrying the Renilla luciferase gene and 50nM miR-124 mimics or negative control using Lipofectamin 2000 (Invitrogen). 24h after transfection, luciferase activity was analyzed using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). Firefly luciferase activity was normalized to that of Renilla luciferase.

RPMI-1640, Dulbecco's Modified Eagle Medium (DMEM), and fetal bovine serum (FBS) were obtained from GIBCO (Grand Island, NY). Lipofectamine 2000 (Lipo 2000) reagent was obtained from Invitrogen (Life Technologies Corporation, Carlsbad, CA). The primers for miR-124 and U6 real-time PCR, miR-124 mimics, miR-124 inhibitor, CD151 siRNA, and their controls were purchased from RiboBio (Guangzhou, China). Antibody against CD151 (Cat No: ab33315) was procured from Abcam (Cambridge, MA). Antibody against Phospho-NOS3-S1177 (Cat No: AP0421) was purchased from ABclonal Biotech (Cambridge, MA). Prestained protein markers were obtained from Fermentas (Thermo Fisher Scientific Inc., Rockford, IL). Polyvinylidene difluoride (PVDF) membranes were from Millipore (Merck KGaA, Darmstadt, Germany). Horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence reagents were from Pierce Biotechnology (Thermo Fisher Scientific Inc., Rockford, IL). Alexa Fluor^® 594 Donkey Anti-Mouse IgG (H+L) Antibody (Cat No: A-21203) were obtained from MOLECULAR PROBES (Thermo Fisher Scientific Inc., Rockford, IL). Other reagents were purchased from the Sigma-Aldrich Company, unless otherwise specified.

Human prostate cancer cell lines PC3, Du145, and 22Rv-1, and the human prostate epithelial cell line RWPE were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The human normal kidney cell line HEK293T was a kind gift by Dr Zhao An from the Central Laboratory of Zhejiang Cancer Hospital. All cells were maintained in RPMI-1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA).
After transfection of miRNA and/or siRNA, cells were harvested, counted, and seeded into six-well plates (Costar, Corning, CA, USA). Lipofectamine 2000™ reagent (Invitrogen) was employed to transfect siRNA (GenePharma, Shanghai, China) miR-124 mimics (RiboBio, Guangzhou, China), and miR-124 inhibitors (RiboBio, Guangzhou, China) into cells at 50, 100, and 200 nM, respectively. For mimics, NC RNA (the negative control), inhibitors, and siRNA, the duration of transfection was 48 h. For co-transfection with plasmids, transfection was performed for 24 h. The sequences were as follows (5′–3′): NC RNA, ACUACUGAGUGACAGUAGA; has-miR-124 [Pubmed Nucleotide: accession number: MI0000443], GGCAUUCACCUCGUGCCUUA; has-miR-124 inhibitors, UAAGGCACGCGGUGAAUGCC; talin 1 siRNA, GAAGCCUCUUCUAUUUAAUGCAGAC.