Genomic DNA was isolated from whole blood using standard procedures. Genotyping for the ATG16L1 T300A (rs2241880) and the IRGM SNPS (rs13361189 and rs4958847) single nucleotide polymorphisms (SNPs) was performed by using the TaqMan single-nucleotide assay C_9095577_20, C_31986315_10 and C_1398968_10, respectively, on the 7300 ABI Real-Time polymerase chain reaction system (all from Applied Biosystems, CA, USA). Two of these polymorphisms (rs2241880 and rs4958847) were also part of the Sequenome (Sequenom MassARRAY®, Sequenom, San Diego, CA) analysis of the study of Smeekens at al (24). However, we chose to assess it in the present study through TaqMan technology in the candidemia cohort, due to the fact that the quality of DNA necessary for Sequenome analysis was not sufficient for the entire cohort of patients. The assessment of all three polymorphisms in the studies on mucosal forms of infections has not been presented elsewhere.
Abi 7300 real time polymerase chain reaction system
Manufactured by Thermo Fisher Scientific
Sourced in United States, France, Germany
The ABI 7300 real-time polymerase chain reaction (PCR) system is a laboratory instrument designed for quantitative PCR (qPCR) analysis. It is capable of performing real-time detection and quantification of nucleic acid sequences during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Sequenom massarray, by Labcorp (1 mentions)
Superscript reverse transcriptase kit, by Transgene (1 mentions)
Super sybr green kit, by Transgene (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Rneasy isolation kit, by Qiagen (1 mentions)
Revertaid rt reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
Revertra ace, by Toyobo (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
Rneasy lipid tissue kit, by Qiagen (1 mentions)
5 protocols using abi 7300 real time polymerase chain reaction system
1
Genotyping of Inflammatory SNPs
2
Genotyping of Immune-related Polymorphisms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from whole blood using the Qiagen (Valencia, CA, USA) isolation kit and following the standard protocol. The genotype for the CLEC7A (DECTIN-1) Tyr328X (rs16910526) and CARD9 Ser12Asn (rs4077515) polymorphisms in the patients was screened by the TaqMan SNP assay C_33748481_10 and C_25956930_20, respectively, (Applied Biosystems, Foster City, CA, USA). The genotype for the TLR1 polymorphism Arg80Thr (rs5743611) was assessed with the TaqMan SNP assay C_27855269_10. The genotype of TLR2 Pro631His (rs5743704) was assessed by applying a predesigned TaqMan SNP assay C_25607736_10. The genotyping for the TLR4 polymorphisms Asp299Gly (rs4986790) and Thr399Ile (rs4986791) was performed with the TaqMan SNP assay C_11722238_20 and C_11722237_20, respectively. The TaqMan qPCR assays were performed on the 7300 ABI Real-Time polymerase chain reaction system (Applied Biosystems). Positive and negative controls were included in the assays.
3
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using TRIzol Reagent (Invitrogen, CA, USA) following the manufacturer’s protocol, and it was reverse transcribed into complementary DNA (cDNA) by using a Superscript Reverse Transcriptase Kit (Transgene, France). A Super SYBR Green Kit (Transgene, France) was used to carry out real-time polymerase chain reaction in an ABI7300 real-time polymerase chain reaction system (Applied Biosystems). The primer pairs were: CXCL13 forward: GCTTGAGGTGTAGATGTGTCC, CXCL13 reverse: CCCACGGGGCAAGATTTGAA; ITLN1 forward: ACGTGCCCAATAAGTCCCC, ITLN1 reverse: CCGTTGTCAGTCCAACACTTTC; TIMP1 forward: CTTCTGCAATTCCGACCTCGT, TIMP1 reverse: ACGCTGGTATAAGGTGGTCTG; TSPAN11 forward: CATCTTTGCGGGCGTACTTG, TSPAN11 reverse: CAGGCAGAAATACGTGGAGAG; HOXD9 forward: GGACTCGCTTATAGGCCATGA, HOXD9 reverse: GCAAAACTACACGAGGCGAA; and GPRC5B forward: CCTCCTCCCTCAGTACGTGTC, GPRC5B reverse: AAGGCAAACGTCAGCCCAAA.
4
Quantitative RT-PCR Analysis of Mouse Heart
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from heart tissue using the RNeasy isolation kit (Qiagen). cDNA was synthesized from total RNA using RevertAid RT Reverse Transcription Kit (Thermo Fisher Scientific). For each replicate in each experiment, RNA from tissue samples of different animals was used. Primers were designed corresponding to mouse mRNA sequences using Primer3 (Table S1 ). Reactions contained PowerUp SYBR green quantitative polymerase chain reaction Master Mix (Applied Biosystems), 500 nmol/L of each primer, and 0.2 µL of template RNA solution. Amplification was carried out using an ABI 7300 real-time polymerase chain reaction system (Applied Biosystems) with uracil-DNA glycosylases activation at 50 °C for 2 minutes, initial denaturation at 95 °C for 2 minutes, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 minute. Relative levels of mRNA expression were calculated using the ∆∆CT method.14 (link) Values were normalized to Gapdh mRNA.
5
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from BMMs was isolated using the RNeasy mini kit (74104; Qiagen, Santa Clarita, CA); total RNA of the aortic arch was extracted with the RNeasy lipid tissue kit (74804; Qiagen); and total RNA from plaque sections was extracted with the RNeasy micro kit (74004; Qiagen). First-strand cDNA was synthesized using ReverTra Ace (FSQ-201; Toyobo, Osaka, Japan). Quantitative polymerase chain reaction was performed using GoTaq qPCR master mix (A6001; Promega, Mannheim, Germany) in an ABI 7300 real-time polymerase chain reaction system (Applied Biosystems, Foster City, CA). Quantitative mRNA results were normalized to 18S mRNA. To assess the specificity of the amplified polymerase chain reaction products, a dissociation curve analysis was performed after the last amplification cycle. Primers used in this study are listed in Table II in the online-only Data Supplement.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!