Rneasy ffpe kit

Total RNA was extracted from cell cultures using TRI REAGENT (Molecular Research Center Inc., OH, USA) according to the manufacturer’s protocol. RNA from bone marrow at diagnosis was extracted with RNeasy FFPE kit (Invitrogen). The reactions were run on an ABI PRISM®7900HT Sequence Detection System; the cycling conditions were 10 min at 95 °C followed by 40 cycles of 15 s at 94 °C and 1 min at 68 °C. In the first step, we determined the stability of a control gene (β-actin) for the normalization of the real-time PCR products. Specific primers for human EZH2, SUZ12 and EED were designed (Table 1). Assays were performed in triplicate. We used the 2^-ΔΔCt method to analyze the data obtained.Table 1

Primer sequences for quantitative real time-polymerase chain reaction

Gene	Sense	Antisense
EZH2	5′cgcttttctgtaggcgatgt 3′	5′tgggtgttgcatgaaaagaa 3′
SUZ12	5′gggagactattcttgatgggaag 3′	5′actgcaacgtaggtccctga 3′
EED	5′gaaattccatccaagagatcca 3′	5′tggatattccataatcgtaaagca3′
β-actin	5′gcgagaagatgacccagatc 3′	5′ggatagcacagcctggatag 3′

Total RNA was extracted from cell cultures using TRI REAGENT (Molecular Research Center Inc., OH, USA) according to the manufacturer’s protocol. RNA from paraffin-embedded tissues was extracted with RNeasy FFPE kit (Invitrogen). The reactions were run on an ABI PRISM^®7900HT Sequence Detection System; the cycling conditions were 10 min at +95 °C (initial denaturation) followed by 40 cycles of 15 s at +94 °C (denaturation) and 1 min at +68 °C (annealing/extension/data collection). Specific primers for human EZH2, SUZ12, and EED were designed (Table 1). In the first step, we determined the stability of a control gene (Beta-actin) for the normalization of the real-time PRC products. Assays were performed in triplicate. We used the 2^−ΔΔCt method to analyse the obtained data.Table 1

Primer sequences for quantitative real time-polymerase chain reaction

Gene	Sense	Antisense
EZH2	5′cgcttttctgtaggcgatgt 3′	5′tgggtgttgcatgaaaagaa 3′
SUZ12	5′gggagactattcttgatgggaag3′	5′actgcaacgtaggtccctga 3′
EED	5′gaaattccatccaagagatcca 3′	5′tggatattccataatcgtaaagca3′
β-actin	5′gcgagaagatgacccagatc 3′	5′ggatagcacagcctggatag 3′

Paraffin-embedded sections of breast cancer tissues and adjacent non-tumorous breast tissues were derived from 56 patients who underwent surgical resection at the First Affiliated Hospital of Zhejiang University College of Medicine from 2010 to 2011. The respective adjacent non-tumorous breast tissue was used as a reference sample for each cancer tissue. Total RNA (including miRNA) was isolated with the RNeasy® FFPE Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol, and was stored at −80°C for further study. Clinical parameters, including age, sex, pathological features and TMN stage, were obtained from patients’ medical records. Detailed sample information is listed in Supplementary Table 3. The study protocol was reviewed and approved by the Ethics Committee of Zhejiang University College of Medicine. Written informed consent was obtained from each patient.