We purchased ivosidenib from MedChemExpress (Monmouth, NJ, USA). We dissolved ivosidenib powder in sterile dimethyl sulfoxide (DMSO) to prepare a 50 mM stock solution stored at −80°C. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was from Sigma Chemical Corporation (St. Louis, MO, USA). We obtained the cell cycle detection kit from BD Biosciences (San Jose, CA, USA). TRIzol reagent was from Invitrogen (Carlsbad, CA, USA), RT reagent Kit and SYBR Green PCR Master Mix were from Promega (Madison, WI, USA). MiRNeasy Mini Kit, miRCURY LNA RT Kit, and miRCURY LNA SYBR Green PCR Kit were from QIAGEN (Valencia, CA, USA).
Rt reagent kit
Manufactured by Promega
Sourced in United States
The RT Reagent Kit contains the necessary components for reverse transcription (RT) of RNA to complementary DNA (cDNA). The kit includes a reverse transcriptase enzyme, buffer, and other reagents required for the RT reaction. The core function of the RT Reagent Kit is to enable the conversion of RNA to cDNA, which is a crucial step in various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Cell cycle detection kit, by BD (1 mentions)
Mircury lna sybr green pcr kit, by Qiagen (1 mentions)
Mircury lna rt kit, by Qiagen (1 mentions)
Sybr green pcr master mix, by Promega (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Sybr green mix, by Takara Bio (1 mentions)
Lightcycler 480 2 system, by Roche (1 mentions)
Sybr1 premix ex taqtm 2 kit, by Takara Bio (1 mentions)
Trizol regent, by Thermo Fisher Scientific (1 mentions)
Mx3000p qpcr system, by Agilent Technologies (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
P stat3, by Cell Signaling Technology (1 mentions)
Matrigel, by Corning (1 mentions)
Annexin 5 propidium iodide apoptosis detection kit, by BD (1 mentions)
β actin, by Cell Signaling Technology (1 mentions)
5 protocols using rt reagent kit
1
Ivosidenib Cell Proliferation Assay
2
Quantitative RT-PCR Analysis of GABPB1-AS1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNAs were extracted using TRIzol kits (Pufei, Shanghai, China) for qRT-PCR analyses. Reverse transcription was then conducted by applying the Promega RT reagent Kit (Promega M-MLV M1705, Madison, USA). qRT‐PCR using SYBR Green Mix (TAKARA, Dalian, China) was carried out on Roche LightCycler 480II system in triplicate. Primers for GABPB1-AS1 and β-actin were synthesized by Genechem Co., Ltd. (Shanghai, China). The mRNA expressions were normalized to β-actin. The expressing levels of lncRNAs were defined based on the threshold cycle (Ct), and calculated using the 2-∆∆CT method. The primers were as follows:
GABPB1-AS1 forward primer:CAACTAGGCAGACTGGGACG,
GABPB1-AS1 reverse primer:AGGTGGCAGTAATCCAAGCA,
β-actin forward primer:GCGTGACATTAAGGAGAAGC,
β-actin reverse primer:CCACGTCACACTTCATGATGG.
3
Quantification of HSPB2 mRNA in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from normal and breast cancer samples using TRIzol regent (Invitrogen). The complementary DNA (cDNA) was prepared via reverse transcription following the protocol of the Promega RT Reagent Kit. Then, PCR was performed using ROTER with SYBR1 Premix Ex TaqTM II Kit (Takara). The forward and reverse primers were 5′-TATGTCCTGCCTGCTGATG-3′ and 5′-GCTGCCTCCTCCTCTTCCT-3′, and the human GAPDH forward and reverse primers were purchased from Sangon Biotech. The relative HSPB2 expression was determined using the standard curve method, and the quantitative normalization of the cDNA in each sample was performed using GAPDH as an internal control. Finally, HSPB2 mRNA levels were expressed as the respective ratios relative to GAPDH mRNA levels.
4
Gene Expression Analysis of Chondrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell pellets at the end of week 3 using Trizol reagent (Thermo Fisher Scientific, USA), and reverse-transcribed to cDNA with RT reagent kit (Promega, USA), according to the manufacturer’s instructions. The qRT-PCR was performed with SYBR Green Realtime PCR Master Mix (Toyobo, Japan) according to the manufacturer’s protocol. The Real-time fluorescence quantitative PCR instrument was Mx3000P QPCR Systems (Agilent Technology Inc., USA) in this study. The specific qRT-PCR reaction system used in this study were as follow: pre-denaturation at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 10s and annealing at 60 °C for 30 s and extension at 72 °C for 30 s. Primers sequences for Akt, SOX9, COL2A1 and GAPDH were listed in Table 1 . The gene expression was analyzed by 2−ΔΔCt method using GAPDH as the internal control. All the experiments were repeated independently three times.
Primer sequence used for real-time PCR analysis
| Genes | Primer sequence (5′-3′) |
|---|---|
| Akt | F: ACGCTACTTCCTCCTCAA R: CTGACATTGTGCCACTGA |
| SOX9 | F: AGCACAAGAAAGACCACCCC R: CGCCTTGAAGATGGCGTTAG |
| COL2A1 | F: GCCAGGATGCCCGAAAATTAG R: GTCACCTCTGGGTCCTTGTTC |
| GAPDH | F: GGCAAGTTCAACGGCACAG R: CGCCAGTAGACTCCACGACA |
5
Calycosin Biological Activity Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CA (purity 99.41% as measured by high-performance liquid chromatography) was purchased from the Shanghai BS Bio-Tech Co., Ltd (Shanghai, China) and dissolved in dimethyl sulfoxide. A total of 7.6 µL of CA was dissolved in 92.4 µL of dimethyl sulfoxide, and the final concentration of CA was 80 mg/ml. The 3-(4,5-Dimethylthiazol-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) was obtained from the Sigma Chemical Corporation (St. Louis, MO, United States). The annexin V/propidium iodide apoptosis detection kit was obtained from BD Biosciences (Franklin Lake, NJ, United States). The Matrigel was purchased from Corning (Wujiang, China). The TRIzol reagent was purchased from Invitrogen (Carlsbad, CA, United States). The RT reagent Kit and SYBR Green polymerase chain reaction (PCR) Master Mix were purchased from Promega (Madison, WI, United States). The primary antibodies against phospho-NF-κB (p-NF-κB) p65, p-JAK, phospho-signal transducer and activator of transcription 3 (p-STAT3), peroxisome proliferator-activated receptor gamma (PPARγ), and β-actin (1:1,000) were purchased from the Cell Signaling Technology Co., Ltd (Danvers, MA, United States).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!