One hundred and sixty thousand cells/mL MM.1S cells were seeded in Opti-MEMTM Reduced Serum Media (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA; cat. no. 31985070) and were allowed to attach over 24 hours (h) before transfection. HiPerFect transfection reagent (Netherlands, Qiagen; cat. no. 301704) and PVT1 GapmeR (200 nM) (Qiagen, Netherlands, cat. no. 339517) were added (1:3,000) and the cells were incubated for 72 h at 37°C in a humidified 5% CO2 in-air atmosphere. Transfection efficiency was evaluated 72 h post transfection using 5-FAM-labeled positive/negative control GapmeR (Qiagen, Netherlands, cat. no. 339515) on Cytoflex LX (Beckman Coulter, Brea, CA, USA). Data was analyzed utilizing CytExpert v.2.4.0.28 (Beckman Coulter). Validation of PVT1 inhibition was evaluated by real-time quantitative polymerase chain reaction.
Opti memtm reduced serum media
Manufactured by Thermo Fisher Scientific
Sourced in United States
Opti-MEMTM Reduced Serum Media is a cell culture medium formulated to support the growth of a variety of cell types while minimizing the amount of serum required. It is designed to provide optimal conditions for cell proliferation and maintenance in a low-serum environment.
Automatically generated - may contain errors
Lab products found in correlation
Cytexpert v2, by Beckman Coulter (1 mentions)
Hiperfect transfection reagent, by Qiagen (1 mentions)
Cytoflex lx, by Beckman Coulter (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Pcdna3, by YouBio (1 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions)
Bace1 5 utr pmirglo, by Sangon (1 mentions)
2 protocols using opti memtm reduced serum media
1
PVT1 Knockdown in MM.1S Cells
2
Plasmids and siRNA for DDX17 and BACE1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human DDX17 pcDNA3.1(+) plasmid, control vector pcDNA3.1(+), human BACE1 +5′UTR (containing the 5′UTR and the entire human BACE1 coding region) pcDNA3.1(+), and human BACE1-5′UTR (only containing the entire human BACE1 coding sequence) pcDNA3.1(+) were obtained from YouBio (Changsha, China). The BACE1 +5′UTR-pmirGLO and BACE1 −5′UTR-pmirGLO were from Sangon Biotech (Shanghai, China). The siRNA oligonucleotide sequences for DDX17 (SiDDX17) and non-targeting control (NC) were designed by GenePharma Biotech (Shanghai, China) as follows: SiDDX17 (sense: GCUGCUUAUGGCACCAGUAGCUAUA; antisense: UAUAGCUACUGGUGCCAUAAGCAGC); and NC (sense: UUCUCCGAACGUGUCACGUTT; antisense: ACGUGACACGUUCGGAGAATT). Cells were transfected with LipofectamineTM 3000 (Invitrogen, USA) or LipofectamineTM RNAiMAX Transfection Reagent (Invitrogen, Carlsbad, CA, USA) mixed with Opti-MEMTM Reduced Serum Media (Gibco, Rockville, MD, USA) according to the manufacturer’s protocols.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!