Chromatin-immunoprecipitation was performed using Magna-ChIP-Kit (Millipore, Darmstadt, Germany) as described.6 (link) protein-G-magnetic-beads (20 μl) were coupled to 7.5 μl of FOXO3 antibody (Santa Cruz Biotechnology, Dallas, TX, USA) or control-IgG and incubated with nuclear lysates of shredded DNA from 2 × 107 cells. After precipitation, protein was digested by proteinase-K and DNA was concentrated with ChIP-DNA-Clean-&-Concentrator-Kit (Zymo Research, Irvine, CA, USA). FOXO3-binding to DNA was quantified by qPCR using promoter-specific primers for FOXO3-targets (Supplementary Table S2 ).
Foxo3 antibody
Manufactured by Santa Cruz Biotechnology
Sourced in United States
The FOXO3 antibody is a protein-specific reagent used to detect the FOXO3 transcription factor in various experimental applications. FOXO3 plays a key role in the regulation of cellular processes such as apoptosis, cell cycle progression, and oxidative stress response. This antibody can be utilized for techniques like Western blotting, immunohistochemistry, and immunoprecipitation to analyze the expression and localization of FOXO3 in different cell and tissue samples.
Automatically generated - may contain errors
Lab products found in correlation
Magna chip kit, by Merck Group (3 mentions)
Chip dna clean concentrator kit, by Zymo Research (1 mentions)
Chip dna clean and concentrator kit, by Zymo Research (1 mentions)
Magna rip rna binding protein immunoprecipitation kit, by Merck Group (1 mentions)
Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Human anti argonaute2 ago2 antibody, by Merck Group (1 mentions)
4 protocols using foxo3 antibody
1
Chromatin Immunoprecipitation of FOXO3
2
ChIP Assay for FOXO3 Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed using Magna-ChIP-Kit (Merck, Germany) as described (Salcher et al., 2014 (link)). 20 µl protein-G-magnetic-beads were coupled to 7.5 µl of FOXO3 antibody (Santa Cruz, Dallas, USA) or control-IgG and incubated with nuclear lysates of shredded DNA from 2 × 107 cells. After precipitation, protein was digested by proteinase-K and DNA was concentrated with ChIP-DNA-Clean- and -Concentrator-Kit (Zymo Research, USA). FOXO3-binding to DNA was quantified by qPCR using promoter-specific primers for FOXO3-targets.
3
CircRNA-FOXO3 and miR-155 Interaction Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Magna RIP™ RNA-Binding Protein Immunoprecipitation kit (Millipore, Billerica, MA, USA) were used for RIP. NSCLC cells were lysed in complete RNA lysis buffer, then cell lysates were incubated with RIP immunoprecipitation buffer containing magnetic beads conjugated with human anti-argonaute 2 (AGO2) antibody (Millipore) or negative control mouse IgG (Millipore). Extracted RNAs were analyzed by RT-qPCR to identify the presence of circRNA-FOXO3.
The RIP experiment using FOXO3 antibody (1:1,000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) to pull down miR-155 was also performed. The RIP RNA fraction was digested by DNase and cDNA was generated using PrimeScript 1st strand cDNA Synthesis kit (Takara Bio., Inc., Otsu, Shiga, Japan). Final analysis was investigated by performing RT-qPCR and presented as a fold enrichment of miR-155.
The RIP experiment using FOXO3 antibody (1:1,000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) to pull down miR-155 was also performed. The RIP RNA fraction was digested by DNase and cDNA was generated using PrimeScript 1st strand cDNA Synthesis kit (Takara Bio., Inc., Otsu, Shiga, Japan). Final analysis was investigated by performing RT-qPCR and presented as a fold enrichment of miR-155.
4
FOXO3 ChIP-qPCR at DEPP Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed using the Millipore Magna ChIP Kit (Millipore, Darmstadt, Germany) as described previously [38 (link)]. Protein-G-magnetic-beads (20 μl) were coupled to 2.5 μl of FOXO3 antibody (Santa Cruz Biotechnology, Dallas, USA) and incubated with nuclear lysates of shredded DNA from 2 × 107 SH-EP/FOXO3 cells treated with 100 nM 4OHT alone or in combination with CBX for three hours. After precipitation, protein was digested by proteinase-K. Quantitative real-time RT-PCR analyses were performed to measure binding of FOXO3 to the DEPP-promoter (DEPP-forward: CTGCTCCTAGGAGAGACACACCCTG, DEPP-reverse: CTGCTACGTTTGCTGTGCTTAGTGC).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!