Nextera xt dna library prep kit

Sample DNA concentrations were determined using a Qubit BR dsDNA assay kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). Concentrations were diluted to 0.2 ng/µL, and libraries were prepared following the Illumina Nextera XT DNA library prep kit (Illumina, Inc., San diego, CA, USA) reference guide with the following exceptions. Forty microliters of PCR product transferred to a new MIDI plate, 20 µL of AMPure XP beads (Beckman Coulter, Brea, CA, USA) were added to each well and incubated at room temperature for 5 min without shaking. After 80% ethanol washes, beads were allowed to air dry for 12 min. Then beads were resuspended in 53 µL of RSB and incubated at room temperature for 2 min without shaking.
The concentration of sample libraries was determined using the Qubit dsDNA HS assay kit (Thermo Fisher Scientific Inc., Waltham, MA, USA), and libraries were diluted to a 2 nM concentration and combined in equal volumes to form the pooled library. The pooled library was denatured to obtain a 10 pM final library following the Illumina Denature and Dilute Libraries Guide-Protocol A. Six hundred µl of the denatured 10 pM library was loaded into the MiSeq reagent cartridge.

PCR products were cleaned using Sera-Mag™ SpeedBeads (Merck KGaA, Darmstadt, Germany) in a Zephyr NGS Workstation (Caliper Lifesciences, Perkin-Elmer; Waltham, MA, USA) and quantified using a Promega dsDNA Quantifluor System Kit (Ref: E2670, 00002484139; Madison, WI, USA) on an Enspire Workstation (Perkin-Elmer; Waltham, MA, USA). The PCR products of all fragments were pooled and normalized to 0.2 ng/µL with 10 mM Tris-HCl (pH 8.0) for library preparation, and final accuracy checks of concentration were performed using the Illumina Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA, USA).

DNA was extracted from all samples using the QIAamp® UCP Pathogen DNA Kit (Qiagen), following the manufacturer’s instructions. Human DNA was removed using Benzonase (Qiagen) and Tween20 (Sigma) [23 (link)]. Libraries were constructed for DNA using the Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA) [24 (link)]. The library quality was assessed using the Qubit dsDNA HS Assay kit followed by a high-sensitivity DNA kit (Agilent) on the Agilent 2100 Bioanalyzer. Library pools were then loaded onto the Illumina NextSeq 550Dx sequencer for 75 cycles of single-end sequencing to generate approximately 20 million reads for each library. For negative controls, we prepared swabs from 10 healthy donors and added 10⁵ HeLa cells/mL using the same protocol. Sterile deionized water was extracted with specimens to serve as non-template controls [24 (link), 25 (link)].

Amplicon PCR was performed on the bacterial total DNA of the V4 region of the 16S rRNA gene using forward primers U515F (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA-3´) or U515F_bar2 (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACGAAGTGCCAGCMGCCGCGGTAA); and the reverse primer E786R (5´- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3´) with Illumina adapter overhang sequences as indicated by the underlined text. Then, a second PCR was performed in order to add two unique Illumina compatible barcodes to each sample, so that the derived sequences could be demultiplexed into their respective samples in downstream analysis (Table S1). These barcodes overlapped with the sequences of the primers used in the first PCR. Purification steps were performed using DNA Purification SPRI Magnetic Beads (Canvax^®, Cordoba, Spain). PCR amplicons were checked by 1% agarose gel electrophoresis. DNA concentrations were measured using Qubit^® 3.0 Fluorometer (Invitrogen™, Carlsbad, CA, USA) and normalized to reach the same concentration per sample. High-throughput sequencing was performed using Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA, USA). This sequencing resulted in paired-end reads of 2 × 300 bp length. Sequencing was carried out on the Illumina MiSeq platform in the Scientific Instrumental Center at the University of Granada (CIC-UGR, Granada, Spain).