miRNA was isolated from EVs, tissues, and cells using the mirVanaTM PARISTM RNA kit (AM1556, Invitrogen). For mRNA analysis, First Strand cDNA Synthesis Kit (K1622, Fermentas Inc., Hanover, MD) was used to randomly synthesize cDNA from 1 μg of total RNA. For miRNA analysis, TaqMan microRNA Reverse Transcription Kit (4366597, Applied Biosystems Inc. Carlsbad, CA) was used to synthesize cDNA of miRNA. Next, RNA was quantitatively analyzed using Fast SYBR Green PCR kit (Applied Biosystems) and ABI PRISM 7300 RT-PCR system (Applied Biosystems), with three repeated wells for each sample. U6 served as the internal reference for miR-138-5p, while GAPDH for the remaining genes. All primers were purchased from Sangon Biotechnology (Shanghai, China), and the sequences are shown in Supplementary Table 1 . Besides, reverse primers of TaqManTM microRNA Reverse Transcription Kit were used.
Abi prism 7300 rt pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, Germany
The ABI PRISM 7300 RT-PCR system is a real-time PCR instrument designed for quantitative gene expression analysis. It utilizes a 96-well block format and can perform both reverse transcription and real-time PCR in a single instrument.
Automatically generated - may contain errors
Lab products found in correlation
Fast sybr green pcr kit, by Thermo Fisher Scientific (31 mentions)
Trizol reagent, by Thermo Fisher Scientific (26 mentions)
Primescript rt reagent kit, by Takara Bio (23 mentions)
Trizol, by Thermo Fisher Scientific (6 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (5 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Mirvana paris rna kit, by Thermo Fisher Scientific (3 mentions)
Primescript rt regent kit, by Takara Bio (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Trizol kit, by Thermo Fisher Scientific (3 mentions)
Sybr green master mix, by Thermo Fisher Scientific (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Fast sybr green pcr reagent, by Thermo Fisher Scientific (2 mentions)
Primescript rt kit, by Takara Bio (2 mentions)
Sybr green pcr kit, by Eurogentec (2 mentions)
Fast sybr green pcr kit, by Takara Bio (2 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Thermo Fisher Scientific (1 mentions)
Ncode mirna first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
51 protocols using abi prism 7300 rt pcr system
1
Isolation and Quantification of miRNA and mRNA
2
Quantification of HOTAIR and HOXA5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the Trizol kit (15596026, Invitrogen Inc., Car, Cal, USA). Based on the instructions of Primescript RT reagent kit (RR047A, TaKaRa, Tokyo, Japan), RNA was reversely transcribed into complementary DNA (cDNA). RT-qPCR was then carried out using the Fast SYBR Green PCR Kit (Applied Biosystems, Carlsbad, CA, USA) on the ABI PRISM 7300 RT-PCR System (Applied Biosystems, Carlsbad, CA, USA). The reaction conditions were as follows: pre-denaturation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 30 s, annealing, and extension at 60 °C for 1 min. Each sample was set with 3 duplicated wells. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene served as an internal reference. The relative expression of HOTAIR and HOXA5 between the experiment group and the control group was calculated based on the 2−∆∆Ct method. The primers sequences are shown in Table 1 .
Primer sequence for RT-qPCR
| Genes | Primer sequence |
|---|---|
| HOTAIR | F: 5′-CAGTGGGGAACTCTGACTCG-3′ |
| R: 5′-GTGCCTGGTGCTCTCTTACC-3′ | |
| HOXA5 | F: 5′-CGCCCAACCCCAGATCTA-3′ |
| R: 5′-GGCCGCCTATGTTGTCATG-3′ | |
| GAPDH | F: 5′-GCCAAGGTCATCCATGACAACT-3′ |
| R: 5′-GAGGGGCCATCCACAGTCTT-3′ |
RT-qPCR reverse transcription quantitative polymerase chain reaction, HOTAIR Hox transcript antisense intergenic RNA, HOXA5 homeobox A5, GAPDH glyceraldehyde-3-phosphate dehydrogenase, F forward, R reverse
3
Comprehensive miRNA and mRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer's instructions, miRNA was isolated from EVs, tissues, and cells by using the mirVanaTM PARISTM RNA kit (AM1556, Invitrogen, CA, USA). For mRNA analysis, cDNA was synthesized randomly from 1 μg of total RNA using the First Strand cDNA Synthesis Kit (K1622, Fermentas, USA) was used to synthesize cDNA randomly from 1 μg of total RNA; for miRNA analysis, the TaqManTM MicroRNA Reverse Transcription Kit (4366597, Applied Biosystems, USA) was used to synthesize cDNA for miRNA. Finally, the Fast SYBR Green PCR kit (Applied biosystems) and the ABI PRISM 7300 RT-PCR system (Applied biosystems) were used to analyze RNA quantitatively, and each sample was repeated for three replicate wells. miR-30c was used with U6 as the internal reference, and the remaining genes were used with GAPDH. The relative gene expression was analyzed by the 2-ΔΔCt method, calculated as △Ct=CT (target gene)−CT (internal reference) and △△Ct=△Ct (Experimental group)−△Ct (control group), repeated the experiment 3 times, and took the average value. All primers were purchased from Sangon Biotech (Shanghai) Co., Ltd. and the primer sequences were as follows Table 1 .
4
Quantifying miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation of total RNA from the cells was performed using Trizol (15596026, Invitrogen) and was reversely transcribed into complementary DNA (cDNA) using PrimeScript RT reagent kit (RR047A) or NCode miRNA First‐Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc). The synthesized cDNA was used to perform RT‐qPCR reactions using Fast SYBR Green PCR Kit (Applied Biosystems) on ABI PRISM 7300 RT‐PCR System (Applied Biosystems). The U6 gene was used as an endogenous control gene for normalizing the expression of miR‐224, whereas glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was taken as the internal reference of other genes. The fold changes between the experiment group and the control group were calculated by means of relative quantification (2−ΔΔCt method). Primer sequences are shown in Table 1 .14 , 15
5
Quantification of miRNA and mRNA Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using Trizol reagents (15596026, Invitrogen) to extract the total RNA, using the PrimeScript RT regent Kit (RR047A, Takara) instruction to reverse transcribe the RNA complementary DNA (cDNA), using the FastSyBR Green PCR kit (Applied Biosystems) to prepare the reaction system for the synthesized cDNA, the abiprism7300 RT-PCR system (Applied biosystems) was performed for quantitative real time-polymerase chain reaction detection. Three repeats per sample. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an internal reference. MiRNA expression was detected using PrimeScript miRNA RT_PCR kit (Takara Biotechnology co, ltd) with u6 as within the miRNA. The primers were as follows: NRST, F5′-CTTTGTCCTTATCTCAAGTTCTCG-3′, R5′-ACCTGTCTTGGCATGGGGGTTA-3′; EGFR, F5′-GGGATGAGTCAGTCAG-3′, R5′-TGGTT CATATTGTCGTCAGGT-3′; GAPDH, F5′TGCACACACTACTTAG-3′, R5′-GGACTGTGTGTGTG-3′; and miRNA-9, F5′-TCCTTTGGATCTCTCTCGCT-3’.
6
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen, USA) was used to collect total RNA from cells and tissues. The RNA was reversely transcribed into cDNA using a SuperScriptRT Kit (Invitrogen, USA). Then, the cDNA was collected for real-time qPCR using the SYBR Green Master Mix (Applied Biosystems Inc., Carlsbad, CA, USA) on an ABI PRISM 7300 RT-PCR System (Applied Biosystems). The primer sequences are listed in Table 1 , and the relative RNA expression was determined using the 2−ΔΔCt method with U6 and GAPDH as the internal references for miRNA and mRNAs, respectively.
Primer Sequences in RT-qPCR
| Gene | Primer Sequence (5ʹ-3ʹ) |
|---|---|
| miR-125a | F: TCCCTGAGACCCTTTAACCT |
| R: GAACATGTCTGCGTATCTC | |
| HDAC1 | F: TGAAGCCTCACCGAATCCGCAT |
| R: TGGTCATCTCCTCAGCATTGGC | |
| ET-1 | F: CTACTTCTGCCACCTGGACATC |
| R: CGCACTGACATCTAACTGCCTG | |
| Col. I | F: CCTCAGGGTATTGCTGGACAAC |
| R: CAGAAGGACCTTGTTTGCCAGG | |
| FN | F: CCCTATCTCTGATACCGTTGTCC |
| R: TGCCGCAACTACTGTGATTCGG | |
| IL-6 | F: TACCACTTCACAAGTCGGAGGC |
| R: CTGCAAGTGCATCATCGTTGTTC | |
| GAPDH | F: GCACCGTCAAGGCTGAGAAC |
| R: TGGTGAAGACGCCAGTGGA | |
| U6 | F: GCTTCGGCAGCACATATACTAAAA |
| R: GCTTCGGCAGCACATATACTAAAAT |
7
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted utilizing TRIzol reagent (15,596,026, Invitrogen) and reversely transcribed into complementary DNA (cDNA) with the help of a PrimeScript RT reagent Kit (RR047A, Takara, Japan). RT-qPCR was conducted by means of Fast SYBR Green PCR kit (Applied Biosystems, Carlsbad, CA) and ABI PRISM 7300 RT-PCR system (Applied Biosystems). Three replicates were prepared for each well. GAPDH was adopted as the normalizer for mRNA. The 2-ΔΔCt method was employed to quantify relative expression of target genes. The primers are summarized in Supplementary Table 2 .
8
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol reagent (Invitrogen) was used to extract the total RNA. Then the reverse transcription reactions were performed with the PrimeScript RT Enzyme mix kit (Takara) to obtain the cDNA for the next reaction. The synthesized cDNA was used with Fast SYBR Green PCR kit (Applied Biosystems) to qRT-PCR on ABI PRISM 7300 RT-PCR system (Applied Biosystems). GADPH served as endogenous control gene for the normalization of the gene levels. 2−ΔΔCt method was used to obtain the related quantitative expression of RNA. The specific primers were as follows: MALAT1, (forward) 5-CTCCCCACAAGCAACTTCTC-3 and (reverse) 5-TTCAACCCACCAAAGACCTC-3; Emr1, (forward) 5-TTTTCAGATCCTTGGCCATC-3 and (reverse) 5-GGGTGGCAAGTGCAGAAGTA-3; CD68, (forward) 5-TGTTCAGCTCCAAGCCCAAA-3 and (reverse) 5-GTACCGTCACAACCTCCCTG-3; IL-1β, (forward) 5-TTCATCTTTGAAGAAGAGCCCAT-3 and (reverse) 5-TCGGAGCCTGTAGTGCAGTT-3; IL-6, (forward) 5-TCCAGTTGCCTTCTTGGGAC-3 and (reverse) 5-AGTCTCCTCTCCGGACTTGT-3; TNF-α, (forward) 5-AGCCGATGGGTTGTACCTTG-3 and (reverse) 5-ATAGCAAATCGGCTGACGGT-3; GADPH, (forward) 5-CGGATTTGGTCGTATTGGG-3 and (reverse) 5-CTGGAAGATGGTGATGGGATT-3. The thermal conditions for all PCR reactions were as follows: 95 °C for 10 mins, 40 cycles of 95 °C for 15 s, 60 °C for 45 s.
9
Quantifying Antioxidant Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated after the RT7 cells were treated with TRIzol reagent plus 5-FU, or γ-tocotrienol or both (Invitrogen Life Technologies, Carlsbad, CA, USA). The cDNA was synthesized from 5 μg of total RNA using an Advantage cDNA PCR kit (Clontech Laboratories, Inc., Palo Alto, CA, USA). For the quantitative real-time PCR, equal aliquots (1 μl) of cDNA were amplified according to the manufacturer’s TaqMan universal (50 μl) PCR master mix protocol using an ABI PRISM 7300 RT-PCR system (Applied Biosystems Japan, Ltd., Tokyo, Japan). The primer set and TaqMan probe mixture used for the PCR were purchased from Applied Biosystems Japan, Ltd. (HO-1: Hs01110250_m1; NQO-1: Hs02512143_s1). The data were normalized using RT-PCR β-actin primers (Hs99999903_m1; Applied Biosystems Japan, Ltd.)
10
Gene Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (15596026, Invitrogen). RNA was reverse-transcribed to cDNA with the PrimeScript RT Reagent Kit (RR047A, Takara, Kusatsu, Japan). Quantitative real-time PCR was performed with the Fast SYBR Green PCR kit (Applied Biosystems, Foster City, CA, USA) and an ABI PRISM 7300 RT-PCR system (Applied Biosystems). Each sample was tested in triplicates. GAPDH was used as an internal reference. Relative expression of target genes normalized to GAPDH (primer sequence shown in Table 3 ) was calculated by the 2−ΔΔCt method.
Primer sequences for qPCR
| Gene | Forward sequence | Reverse sequence |
|---|---|---|
| GAPDH | 5′-GAAGGTGAAGGTCGGAGTC-3′ | 5′-GAAGATGGTGATGGGATTTC-3′ |
| SIRT1 | 5′-ACAGGTTGCGGGAATCCAAA-3′ | 5′-GTTCATCAGCTGGGCACCTA-3′ |
qPCR, quantitative polymerase chain reaction.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!