Log In Sign up
The largest database of trusted experimental protocols

Luna qpcr master mix

Manufactured by New England Biolabs
Visit Supplier
Sourced in United States, Japan

Luna qPCR master mix is a ready-to-use solution for quantitative real-time PCR (qPCR) reactions. It contains all the necessary components, including a hot-start DNA polymerase, dNTPs, and buffer, to perform qPCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

Trizol, by Thermo Fisher Scientific (11 mentions) Turbo dnase, by Thermo Fisher Scientific (5 mentions) Total rna miniprep kit, by New England Biolabs (2 mentions) Protoscript 2 first strand cdna synthesis kit, by New England Biolabs (2 mentions) Mastercycler realplex2, by Eppendorf (2 mentions) Lunascript rt supermix kit, by New England Biolabs (2 mentions) Zymo direct zol rna miniprep kit, by Zymo Research (2 mentions) Viia7 qpcr machine, by Thermo Fisher Scientific (2 mentions) Multiscribe reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Nanodrop one spectrophotometer, by Thermo Fisher Scientific (1 mentions) Icycler real time pcr detection system, by Bio-Rad (1 mentions) Isogen 2, by Fujifilm (1 mentions) Revertra ace qpcr rt master mix with gdna remover, by Toyobo (1 mentions) Primetime gene expression master mix, by Integrated DNA Technologies (1 mentions) Lightcycler 480 2 system, by Roche (1 mentions) Rna extraction kit, by Favorgen Biotech (1 mentions) Mic qpcr cycler, by Bio Molecular Systems (1 mentions) Dnase free rnase, by Merck Group (1 mentions) First strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Thermal cycler dice real time system 2, by Takara Bio (1 mentions)

29 protocols using luna qpcr master mix

1

Quantitative RT-PCR Analysis of Plant Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
A quantitative real-time polymerase chain reaction (RT-PCR) test was conducted using Luna qPCR master mix (NEB, Ipswich, MA, USA) with three technical replications for each sample. The primers used for qPCR were as follows:
at1g65230-FAATCCGCAAAAGATGTCGCCat1g65230-RGACAATGGCTAGAAACAGTGCAALOC_Os01g68450-FAGGGTACAGCATCTCGGCTALOC_Os01g68450-RCAGGAAGAGCGCAATCTGGTEF1α-FTGCCGCAGGTGAATCAAAGGEF1α-RCCCAATTACGAGAACAACGCTCTGThe PCR process was as follows: initial denaturation at 95 °C for 60 s followed by 40 cycles of denaturation at 95 °C for 15 s and extension at 61.5 °C for 30 s and 95 °C for 5 s. The melt curve is at 60–94 °C with a 5 °C increase every 5 s. The transcription levels were normalized using EF1α [31 (link)]. The relative expression levels were calculated using the ∆∆Ct method [32 (link)].
Punchkhon C., Chutimanukul P., Chokwiwatkul R., Saputro T.B., Grennan A.K., Diego N.D., Spíchal L, & Chadchawan S. (2022). Role of LOC_Os01g68450, Containing DUF2358, in Salt Tolerance Is Mediated via Adaptation of Absorbed Light Energy Dissipation. Plants, 11(9), 1233.
+ Open protocol
+ Expand
2

Quantifying RNA Expression in Fish Retina

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Fish were dark adapted overnight, anesthetized in tricaine, and then eyes were harvested and placed in a tray of ice-cold phosphate-buffered saline (PBS) for retinal dissection. Dissected retinas (generally 3 replicates) were placed into 400 μL TRIzol (Invitrogen) and dissociated by trituration using, first a P200 Pipettman, and then a 1-mL syringe equipped with a 30-g needle. RNA was then purified using the manufacturer’s (TRIzol, Invitrogen) recommendations. RNA concentration was determined on a NanoDrop One spectrophotometer (Thermo Fisher), and ~1 μg RNA was used for cDNA synthesis using M-MLV or SSIII reverse transcriptase (Invitrogen) according to the manufacturer’s directions. cDNA was diluted 1/5 and 1 μL was used for PCR as previously described 69 (link), 70 (link). We used a Luna qPCR Master Mix (NEB) and an iCycler real-time PCR detection system (BioRad) to carry out real-time PCR. The △△Ct method was used to determine mRNA expression levels, and this was normalized to gapdhs for determining fold change in RNA expression.
Mitra S., Devi S., Lee M.S., Jui J., Sahu A, & Goldman D. (2022). Vegf signaling between Müller glia and vascular endothelial cells is regulated by immune cells and stimulates retina regeneration. Proceedings of the National Academy of Sciences of the United States of America, 119(50), e2211690119.
+ Open protocol
+ Expand
3

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA extracted from cell lines and mouse livers using Isogen II (Wako) was transcribed to cDNA using ReverTraAce qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). cDNA was used for quantitative PCR using Luna qPCR Master Mix (New England Biolabs, Tokyo, Japan) and PrimeTime Gene Expression Master Mix (Integrated DNA Technologies, Tokyo, Japan) with the specific primers on a LightCycler 480 system II (Roche). Levels of mRNA expression were normalized relative to Gapdh and TBP mRNA as an internal control using ΔΔCt method. Nucleotide sequences of the primers are shown in Supplemental Table 1.
Kasano-Camones C.I., Takizawa M., Iwasaki W., Sasaki S., Hamada M., Morimoto A., Sakaguchi M., Gonzalez F.J, & Inoue Y. (2020). Synergistic regulation of hepatic Fsp27b expression by HNF4α and CREBH. Biochemical and biophysical research communications, 530(2), 432-439.
+ Open protocol
+ Expand
4

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using TRIzol (Thermo Fisher) and treated with Turbo DNase (Thermo Fisher). cDNA was synthesized using oligo(dT) and M-MLV reverse transcriptase with 1.5–2 μg of RNA. cDNA was then mixed with real-time PCR primers and Luna qPCR master mix (NEB). PCR was run on an Applied Biosciences StepOne Plus Real-Time PCR system. Data were analyzed using the ΔΔCt method for gene expression.
Wang R., Zheng D., Wei L., Ding Q, & Tian B. (2019). Regulation of Intronic Polyadenylation by PCF11 Impacts mRNA Expression of Long Genes. Cell reports, 26(10), 2766-2778.e6.
+ Open protocol
+ Expand
5

Quantitative Real-Time RT-PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated by using an RNA extraction kit (Favorgen, Taiwan). 250 ng of total RNA was treated with RNase-free DNase (Sigma-Aldrich, St. Louis, MO, USA) for 15 min. After the inactivation of DNase with EDTA and heating, RNA was reverse transcribed using First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) according to the manufacturer's instructions. Quantitative RT-PCR was performed on cDNA samples using the Luna qPCR master mix (NEB, Ipswich, MA, USA) by using the Mic qPCR Cycler (Bio Molecular Systems, Australia). Relative mRNA levels are presented as values of 2^[Ct(Rpl32)–Ct(gene of interest)]. For data presentation, the mRNA level in the control cell was set to 1. The sequences of the forward and reverse primers are shown in Table 1.
Kang M., Cho J.H., Kim T.J., Lee S.M., Kim H.J., Coronado I., Yi D.K, & Kim D.Y. (2020). Quadrella incana (Capparaceae) Leaf Extract Enhances Proliferation and Maintenance of Neural Stem/Progenitor Cells through Upregulating Glycolytic Flux and Redox Potential. Oxidative Medicine and Cellular Longevity, 2020, 5963037.
+ Open protocol
+ Expand
6

STING Variant Expression in Macrophages

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse macrophages stably expressing different STING variants were stimulated with DMSO as a control or 500 μg mL−1 CMA (10-carboxymethyl-9-acridanone, Sigma) for 2 or 4 h. Cells were scraped into HBSS, pelleted by centrifugation at 1,000 g for 5 min at 4 °C. The pellet was re-suspended in three volumes of NP40 lysis buffer (50 mM HEPES-KOH pH 7.5, 150 mM KCl, 2 mM EDTA, 0.5% Nonidet P-40 alternative, 0.5 mM DTT), incubated for 10 min on ice and cleared by centrifugation at 13,000 × g for 10 min at 4 °C. RNAs were isolated by phenol-chloroform extraction and ethanol precipitation. cDNA was reverse transcribed using random hexamers and MMLV M5 reverse transcriptase (Arezi and Hogrefe, 2009 (link)). qPCR was performed using the NEB Luna qPCR master mix and the following oligonucleotides: GAPDH-Forward, 5′-GGAGATTGTTGCCATCAACGACC-3′; GAPDH-Reverse, 5′-GTGGGGTCTCGCTCCTGG-3′; IFNB-Forward, 5′-CTCCAGCTCCAAGAAAGGAC-3′; IFNB-Reverse, 5′-TGGCAAAGGCAGTGTAACTC-3′ (Gulen et al., 2017 (link)); NOS2-Forward, 5′-CACCTTGGAGTTCACCCAGT-3′; NOS2-Reverse, 5′-TGGTCACCTCCAACACAAGA-3′; CCL12-Forward, 5′-TCCTCAGGTATTGGCTGGAC-3′; CCL12-Reverse, 5′-TGGCTGCTTGTGATTCTCCT-3′. GAPDH was used as an endogenous normalization control and quantitative RT-qPCR was performed in duplicate biological samples.
de Oliveira Mann C.C., Orzalli M.H., King D.S., Kagan J.C., Lee A.S, & Kranzusch P.J. (2019). Modular Architecture of the STING C-Terminal Tail Allows Interferon and NF-κB Signaling Adaptation. Cell reports, 27(4), 1165-1175.e5.
+ Open protocol
+ Expand
7

STING Variant Expression in Macrophages

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse macrophages stably expressing different STING variants were stimulated with DMSO as a control or 500 μg mL−1 CMA (10-carboxymethyl-9-acridanone, Sigma) for 2 or 4 h. Cells were scraped into HBSS, pelleted by centrifugation at 1,000 g for 5 min at 4 °C. The pellet was re-suspended in three volumes of NP40 lysis buffer (50 mM HEPES-KOH pH 7.5, 150 mM KCl, 2 mM EDTA, 0.5% Nonidet P-40 alternative, 0.5 mM DTT), incubated for 10 min on ice and cleared by centrifugation at 13,000 × g for 10 min at 4 °C. RNAs were isolated by phenol-chloroform extraction and ethanol precipitation. cDNA was reverse transcribed using random hexamers and MMLV M5 reverse transcriptase (Arezi and Hogrefe, 2009 (link)). qPCR was performed using the NEB Luna qPCR master mix and the following oligonucleotides: GAPDH-Forward, 5′-GGAGATTGTTGCCATCAACGACC-3′; GAPDH-Reverse, 5′-GTGGGGTCTCGCTCCTGG-3′; IFNB-Forward, 5′-CTCCAGCTCCAAGAAAGGAC-3′; IFNB-Reverse, 5′-TGGCAAAGGCAGTGTAACTC-3′ (Gulen et al., 2017 (link)); NOS2-Forward, 5′-CACCTTGGAGTTCACCCAGT-3′; NOS2-Reverse, 5′-TGGTCACCTCCAACACAAGA-3′; CCL12-Forward, 5′-TCCTCAGGTATTGGCTGGAC-3′; CCL12-Reverse, 5′-TGGCTGCTTGTGATTCTCCT-3′. GAPDH was used as an endogenous normalization control and quantitative RT-qPCR was performed in duplicate biological samples.
de Oliveira Mann C.C., Orzalli M.H., King D.S., Kagan J.C., Lee A.S, & Kranzusch P.J. (2019). Modular Architecture of the STING C-Terminal Tail Allows Interferon and NF-κB Signaling Adaptation. Cell reports, 27(4), 1165-1175.e5.
+ Open protocol
+ Expand
8

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three hours after the last boost of the NIR light exposure protocol, total RNA was extracted from HAECs or THP-1 cells using a Total RNA Miniprep Kit (New England Biolabs, Evry, France), according to the manufacturer’s instructions. cDNA was synthesized from 1 µg total RNA using a ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Evry, France). Quantitative RT-PCR was performed using Luna qPCR master mix (New England Biolabs, Evry, France). The specific primers are listed in Supplementary Table S1. Mastercycler® RealPlex2 (Eppendorf, Evry-Courcouronnes, France) was used to perform amplification with the following thermal cycling conditions: denaturation at 95 °C for 1 min followed by 40 cycles of denaturation at 95 °C for 15 s, and annealing and elongation at 60 °C for 45 s. A dissociation curve for each well was performed by running the following program: 95 °C for 15 s, 60 °C for 15 s and 60 to 95 °C at 2 °C/min. The obtained Ct (cycle threshold) values of the target genes were normalized to the NAPDH housekeeping gene, and the 2−ΔΔCT method was used to calculate fold changes [38 (link)]. Three biological replicates were performed for each gene (n = 3).
Aguida B., Chabi M.M., Baouz S., Mould R., Bell J.D., Pooam M., André S., Archambault D., Ahmad M, & Jourdan N. (2023). Near-Infrared Light Exposure Triggers ROS to Downregulate Inflammatory Cytokines Induced by SARS-CoV-2 Spike Protein in Human Cell Culture. Antioxidants, 12(10), 1824.
+ Open protocol
+ Expand
9

Quantifying Plant RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from shoots and roots of 7-day-old seedlings was extracted as described previously [30]. Approximately 1 μg of total RNA was reverse-transcribed with a Verso cDNA Synthesis Kit (Thermo Fisher Scientific, Yokohama, Japan) following the manufacturer’s protocol. Real-time PCR was performed with Thermal Cycler Dice Real Time System II (Takara Bio, Shiga, Japan) and Luna qPCR Master Mix (New England Biolabs, Tokyo, Japan). Actin2 was used for the normalization of cDNA concentration. The primers for the detection of used were as follows: 5ʹ-GATGCGATCATACCAGCACT-3ʹ (FP) and 5ʹ-GGATGCAACACGAGGACTTC-3ʹ (RP) for 5S rRNA, 5ʹ-CCTGCGGCTTAATTTGACTC-3ʹ (FP) and 5ʹ-GACAAATCGCTCCACCAACT-3ʹ (RP) for 18S rRNA, 5ʹ-CGCGAGTTCTATCGGGTAAA-3ʹ (FP) and 5ʹ-CACTTGGAGCTCTCGATTCC-3ʹ (RP) for 25S rRNA, and 5ʹ-AAGTCATAACCATCGGAGCTG-3ʹ (FP) and 5ʹ-ACCAGATAAGACAAGACACAC-3ʹ (RP) for ACT2.
Sakamoto T., Sugiyama T., Yamashita T, & Matsunaga S. (2019). Plant condensin II is required for the correct spatial relationship between centromeres and rDNA arrays. Nucleus, 10(1), 116-125.
+ Open protocol
+ Expand
10

Quantitative RT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted with Qiazol (Qiagen, Hilden, NRW, Germany) according to the manufacturer’s specifications. Purified RNA (500 ng) was reverse transcribed using LunaScript RT SuperMix Kit (New England Biolabs). Quantitative PCR was performed with Luna qPCR Master Mix (New England Biolabs). Relative quantification was calculated using the comparative Ct method (ΔΔCt) (61 (link)), and relative expression was normalized to human ACTB. Experiments were performed in independent biological replicates (n = 3); each sample was analyzed in a technical triplicate, the average of which was plotted against the respective conditions used. Primers were designed using NCBI Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table S1).
Diez A.F., Leroux L.P., Chagneau S., Plouffe A., Gold M., Chaparro V, & Jaramillo M. (2023). Toxoplasma gondii inhibits the expression of autophagy-related genes through AKT-dependent inactivation of the transcription factor FOXO3a. mBio, 14(4), e00795-23.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!