LAMP2 3′UTR fragments and mutants containing the miR221 binding site were synthesized and inserted downstream of the luciferase gene in the vector. Mutant (mut) LAMP2 3′UTR was constructed using a site-directed mutagenesis kit (Promega Corporation). The luciferase reporter vector was pGL3 (Shaanxi Youbio Technology Co., Ltd.). 1×105 LX2 cells were transfected with wild-type (wt) LAMP2 3′UTR or mut LAMP2 3′UTR together with miR221 mimics or miR-NC using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). After transfection for 48 h, a dual-luciferase reporter assay was performed to measure the luciferase activity (Promega Corporation). Luciferase activity was normalized against Renilla luciferase activity (Promega Corporation).
Renilla luciferase activity
Manufactured by Promega
Sourced in United States
Renilla luciferase activity is a lab equipment product used to measure the activity of the Renilla luciferase enzyme. Renilla luciferase is a naturally occurring enzyme that produces bioluminescence and is commonly used as a reporter gene in various biological assays.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (11 mentions)
Dual luciferase reporter assay system, by Promega (7 mentions)
Dual luciferase reporter assay, by Promega (4 mentions)
Psicheck 2, by Promega (4 mentions)
Lipofectamine, by Thermo Fisher Scientific (3 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions)
Glomax luminometer, by Promega (2 mentions)
Effectene, by Qiagen (2 mentions)
Pgl3 control vector, by Promega (2 mentions)
Pmirglo vector, by Promega (2 mentions)
Psicheck 2, by Thermo Fisher Scientific (2 mentions)
Site directed mutagenesis kit, by Promega (1 mentions)
Site directed mutagenesis kit, by New England Biolabs (1 mentions)
Pgl4.20 luciferase reporter vector, by Promega (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Exfect transfection reagent, by Vazyme (1 mentions)
Gv126 vector, by Promega (1 mentions)
Protein g sepharose, by GE Healthcare (1 mentions)
Protease inhibitor cocktail, by Roche (1 mentions)
Lipofectamine reagent, by Thermo Fisher Scientific (1 mentions)
35 protocols using renilla luciferase activity
1
Luciferase Assay for miR-221 Targeting LAMP2 3'UTR
2
Characterizing KLF2 Regulation of MIF Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A human MIF gene promoter fragment (−1053 ~ +24 bps) containing the predicted KLF2 core binding motif (CACCC) was cloned from genomic DNA and inserted into the pGL4.20 luciferase reporter vector (Promega, Madison, WI, USA). Mutation of the putative KLF2 binding motif (CATT C) was generated using the Site-Directed Mutagenesis kit (New England Biolabs, MA, USA). AD293 cells were co-transfected with these plasmids plus pRL-TK Renilla luciferase control reporter vector at 80% confluence with Lipofectamine 2000 (Invitrogen, CA, USA) in Opti-MEM (Life Technologies, CA, USA) for 4 hours followed by 48-hour incubation in DMEM with 10% FBS. Dual-luciferase activities were detected with a dual-luciferase reporter assay in accordance with the recommended protocol and all data were normalized to Renilla luciferase activity (Promega, Madison, WI, USA). For adenovirus infection, confluent ECs were infected with targeted adenovirus for 2 hours followed by fresh medium incubation. Infected ECs were then used for experiments after 48 hours.
3
HO-1 Promoter Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A luciferase vector containing the wild-type HO-1 promoter (~-5000 to -1, relative to the transcription start site) was constructed by Shanghai Biobuy Biotech Co., Ltd. (Shanghai, China). The plasmid was verified by sequencing. Cells were transfected with vectors using ExFectTM Transfection Reagent (Vazyme Biotech, Nanjing, China). Promoter activity was expressed as the ratio of firefly luciferase activity to Renilla luciferase activity (Promega, Madison, WI).
4
Dual-Luciferase Assay for miRNA Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full-length MEPCE 3′UTR and ST8SIA6-AS1 were amplified and cloned into pmirGLO vectors (Promega Corp.) to construct the pmirGLO-MEPCE-WT reporter gene plasmid (5′-CAGCAAGGCUGGCUGGUGCUGGA-3′) and pmirGLO-ST8SIA6-AS1-WT reporter gene plasmid (5′-GAACAGAAUCGCUAAUAUGCUGG-3′), respectively. Mutations within the miR-338 binding site were created using the QuikChange II Site-Directed Mutagenesis kit (Stratagene; Agilent Technologies, Inc.), to generate the pmirGLO-MEPCE-MUT (5′-CAGCAAGGCUGGCUGGCAACAAC-3′) reporter gene plasmid and pmirGLO-ST8SIA6-AS1-MUT (5′-GAACAGAAUCGCUAAACCAACAA-3′) reporter gene plasmid. Hep3B and Huh-7 cells were co-transfected with miR-338 mimics or NC mimics and ST8SIA6-AS1-WT (or MEPCE-WT) or ST8SIA6-AS1- Mut (or MEPCE-Mut) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Following 48 h of transfection, the relative luciferase activity was analyzed using a Dual-Luciferase Reporter assay system. Firefly luciferase activity was normalized to Renilla luciferase activity (Promega Corp.).
5
Luciferase Assay for miRNA Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3’ untranslated region (UTR) sequence of SP1 or PARP containing the predicted mo-miR-7a binding sites was amplified from MCM genome and sub cloned into the multiple cloning sites in the downstream of the luciferase gene in the GV126 vector (Promega Corporation, Durham, NC, USA), resulting in the wild-type luciferase reporter construct, GV126-SP1-3’UTR-WT or GV126-PARP-3’UTR-WT . The mutant types, GV126-SP1-3’UTR-MU and GV126-PARP-3’UTR-MU , with the corresponding mutant seed sequence, were synthesized by site-directed mutagenesis [28 ]. These GV126 constructs expressing firefly luciferase and pRL-cmv vectors expressing Renilla luciferase (Genechem) were co-transfected into cells using Lipofectamine 2000 (Invitrogen). Luciferase activity was measured with the Dual-Luciferase Reporter Assay System (Promega Corporation), with Renilla luciferase activity as an internal control.
6
Quantitative Renilla Immunoprecipitation Assay
7
NF-κB Activity Measurement via Dual-Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NF-kappaB activity was determined using a Dual-Luciferase reporter assay system (Promega Corporation, Madison, WI, USA). Briefly, the MOVACs were incubated in 6-well plates(5×105 cells/mL) and co-transfected with 1 μg NF-kappaB reporter plasmid and 100 ng control Renilla luciferase vector (pRL-TK; (Invitrogen; Thermo Fisher Scientific, Inc.) using Lipofectamine reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer’s protocols. Following transfection, the cells were incubated for 10 minutes at room temperature and then cultured for five hours in complete culture medium. Following removal of Lipofectamine from the medium, 10 ng/mL of TNF-α was added, and the cells were harvested four hours later. The luciferase activity was measured in duplicate in each experiment using the Dual Luciferase reporter assay system. The firefly luciferase activity of NF-kappaB was normalized to the Renilla luciferase activity (Promega Corporation). The luciferase activities of samples containing the NF-kappaB responsive element were compared with the luciferase activities in samples transfected with the control plasmid, and reported as the fold increase.
8
HOXA5 Promoter Methylation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 505 bp DNA fragment (−565 bp to −60 bp from TSS) corresponding to the HOXA5 minimal promoter and containing 36 CpG sites was amplified by PCR and cloned into a CpG-free basic firefly luciferase reporter vector (pCpG-basic; InvivoGen, Toulouse France, #pCpGf-basIc). Primers are shown in Table S1 . Luciferase assays were carried out as reported in [9 (link)]. In vitro methylation was performed using the M.SssI CpG methyltransferase (New England Biolabs, Ipswich, Massachusetts, USA, #M0226L) and S-adenosylmethionine (SAM; New England Biolabs, #B9003S), following the manufacturer’s instructions. Unmethylated constructs were treated as the methylated construct, including application of SAM, but in the absence of M.SssI (mock-treated). In vitro methylation was confirmed by resistance to HhaI or HpaII (New England Biolabs) digestion. Constructs were transfected into ChubS7 cells (immortalized human preadipose cell line) by lipofectamine (Thermo Fisher Scientific, #L3000-015), following the manufacturer’s instructions. Transfection of ChubS7 with the mock-treated empty vector was used to control for background firefly luciferase activity. Firefly luciferase activity of each transfection was normalized against renilla luciferase activity (Promega, Madison, WI, USA, #E2231).
9
Transcriptional Analysis of HO-1 Promoter Activity
10
Validating miR-488-5p Binding Sites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bioinformatics analysis using mirDB (mirdb.org/) and TargetScan 7.1 (targetscan.org/vert_71/) was used to predict binding sites. The predicted binding sites of miR-488-5p on CAIF and AVEN mRNA were cloned into pGL3 luciferase reporter vector (Promega Corporation) and named CAIF-wild-type (WT) and AVEN-WT, respectively. Vectors with mutated sequences at the predicted binding sites were also synthesized and named CAIF-mutant (MUT) and AVEN-MUT, respectively. The cells were co-transfected with miR-488-5p mimics or miR-control and MUT or WT vectors using a Lipofectamine® 3000 kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions at room temperature. TRL-SV40 vector served as an internal reference. At 48 h post-transfection, the luciferase activity was detected using a dual-luciferase assay kit and normalized to Renilla luciferase activity (Promega Corporation). The sequences were as follows: miR-488-5p sequences: mimic, CCCAGATAATGGCACTCTCAA; inhibitor: TTGAGAGTGCCATTATCTGGG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!