Poly(lactic-co-glycolic) acid (PLGA) (MW 15,000, ratio of lactide to glycolic acid molar ratio of 50:50), polyethylene glycol (PEG) (MW:3500), PLGA-PEG polymer material was customized from Jinan Daigang Biotechnology Co., LTD. Amphotericin B (AmB) powder (99.8% purity), crystal violet (CV),polyvinyl alcohol (PVA), dimethyl sulfoxide (DMSO), 2,3-bis(2-methoxy-4-nitro-5-sulfo-phenyl)-2H-tetrazolium-5-carboxanilide (XTT), estradiol cypionate, 1,1'-dioctadecyl-3,3,3',3'-tetramethylindo carbocyanine perchlorate (DiI) red fluorescence probe, 4,6-diamidino-2-phenylindole (DAPI), dialysis bags (molecular weight cut-off of 12 kDa) were purchased form Sigma-Aldrich (St. Louis, MO, USA). Tissue-Tek OCT Compound (Sakura Finetek U.S.A. Inc.). Sabouraud Dextrose Agar (SDA), Sabouraud Dextrose broth (SD) and Man Rogosa and Sharpe broth/Agar (MRS)were obtained from Huankai Microbial Co.(Guangdong, China). RPMI 1640 medium, Dulbecco’s Modifed Eagle’s Medium (DMEM), fetal bovine serum (FBS) and phosphate-buffered saline (PBS, pH = 7.0/5.5) was supplied by Thermo Fisher Scientific (Massachusetts, USA). ELISA kits for IL-2, IL-4, IL-6, IL-17, TNF-α and IFN-γ were purchased from Jingmei Biotechnology Co. (Jiangsu, China). CCK-8 (Dojindo, Japan).
2 3 bis 2 methoxy 4 nitro 5 sulfophenyl 2h tetrazolium 5 carboxanilide
Manufactured by Merck Group
Sourced in United States
2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide is a chemical compound used in colorimetric assays. It functions as a tetrazolium dye that undergoes reduction to form a colored formazan product.
Automatically generated - may contain errors
Lab products found in correlation
Phenazine methosulfate, by Merck Group (2 mentions)
Menadione, by Merck Group (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Estradiol cypionate, by Merck Group (1 mentions)
1 1 dioctadecyl 3 3 3 3 tetramethylindo carbocyanine perchlorate dii red fluorescence probe, by Merck Group (1 mentions)
Phosphate buffered saline (pbs), by Thermo Fisher Scientific (1 mentions)
Cck 8, by Dojindo Laboratories (1 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (1 mentions)
Tissue tek oct compound, by Sakura Finetek (1 mentions)
Dichlorofluorescein diacetate, by Merck Group (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Streptomycin, by Thermo Fisher Scientific (1 mentions)
Trypsin, by Thermo Fisher Scientific (1 mentions)
Tri rna reagent, by Favorgen Biotech (1 mentions)
Il 6 elisa kit, by Abcam (1 mentions)
Fungizone, by Thermo Fisher Scientific (1 mentions)
Glutamine, by Thermo Fisher Scientific (1 mentions)
Griess reagent, by Promega (1 mentions)
Celltiter glo luminescence assay kit, by Promega (1 mentions)
9 protocols using 2 3 bis 2 methoxy 4 nitro 5 sulfophenyl 2h tetrazolium 5 carboxanilide
1
PLGA-PEG Polymer-based Amphotericin B Delivery
2
Comprehensive Cell Culture Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture medium and supplements, such as minimum essential medium (MEM), Roswell Park Memorial Institute medium 1640 (RPMI-1640), neurobasal medium, glutamine, penicillin, streptomycin, fungizone, and trypsin, were acquired from Invitrogen (Waltham, MA, USA). B-27 and fetal bovine serum (FBS) were purchased from Thermo Fisher Scientific (Waltham, MA, USA) and HyClone (Logan, UT, USA), respectively. The IL-6 ELISA kit was purchased from Abcam (Cambridge, MA, USA). The Griess reagent and CellTiter-Glo® Luminescence assay kit were purchased from Promega (Madison, WI, USA). Tri-RNA Reagent was purchased from Favorgen (Kaohsiung, Taiwan). The 2× qPCRBIO SyGreen 1step Lo-ROX was obtained from PCR Biosystems (Wayne, PA, USA). 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2HTetrazolium-5-Carboxanilide (XTT), phenazine methosulfate (PMS), Aβ42 peptides, hexafluoropropanol, poly-l-lysine (PLL), dichlorofluorescein diacetate (DCFDA), were obtained from Sigma-Aldrich (St. Louis, MO, USA). Unless otherwise noted, all additional reagents and standards were from Sigma-Aldrich.
3
Cytotoxicity Assay for Staphylococcal Toxins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Culture supernatant containing PEG-precipitated RTX toxins and culture supernatant containing HpmA were incubated at various concentrations (2-fold dilutions) with the indicated cell lines at 1 × 106 to 2 × 106 cells/ml for 1 to 3 h at 37°C. S. aureus α-toxin was incubated with the indicated cell lines at 2 × 106 cells/ml for 24 h at 37°C. Cells were washed, and cell metabolism as a proxy for cell viability was measured by a standard XTT assay with colorimetric development of XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide at 0.5mg/ml (Sigma)] with PMS (N-methyl dibenzopyrazine methyl sulfate; 3.8 μg/ml [Sigma]) diluted in RPMI medium without phenol red (Sigma) (48 (link)). Cells were incubated with XTT solution at 37°C for 1 to 3 h before measuring absorbance at 450 nm. Results were normalized to cells treated with Triton X-100 as 100% death and RPMI alone as 0% death. CD50 values were determined, and statistics were performed in GraphPad Prism version 6.0 (GraphPad Software).
4
Multifunctional Nanoparticle Drug Delivery System
5
Inhibition of C. albicans Biofilms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The inhibiting effects on C. albicans biofilms were assessed as described previously by71 (link). Briefly, 8 × 104 C. albicans cells were added to the wells of a 96 well plate, together with the samples (supernatant, lactic acid, Msp1) or controls (MRS or H2O). After incubation for 24 h at 37 °C, the biofilms were washed twice and then 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (90 µl, 1 mg/ml) (Sigma Aldrich) and phenazine methosulphate (10 µl, 0.2 mg/ml) (Sigma Aldrich) were added to the wells. After a second incubation (37 °C, 30 minutes, in the dark), the absorbance at 492 nm was measured using a Synergy HTX multi-mode reader (Biotek, Drogenbos, Belgium).
6
Formulation and Characterization of Antioxidant Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ethyl acetate (EtOAc), methanol (MeOH), toluene, hexane, formic acid, diethylether, glacial acetic acid, petroleum ether, sulfuric acid 96% (H2SO4) and dimethylsulfoxide (DMSO) were purchased from Carlo Erba (Val de Reuil, France). Dimethyl carbonate (DMC), sodium alginate, (±)-α-tocophérol 96% (vitamin E), oleic acid, linoleic acid, palmitic acid, myristic acid, stearic acid, palmitoleic acid, γ-linolenic acid, 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT), menadione and glucose were purchased from Sigma Aldrich (Saint-Quentin Fallavier, France). Phosphoric acid 85% was purchased from Merck pro analysis (Darmstad, Germany). Labrafac®® WL 1349 was purchased from Gattefossé (Saint-Priest, France). Montane 80®® and Montanox 80®® were purchased from Seppic (Castres, France). Copper nitrate Cu(NO3)2 was purchased from Fisher Scientific SAS (Illkirch, France). Vanillin, acetic acid trihydrate 99+% were purchased from Acros Organics (Geel, Belgium). Water was purified using a Milli-Q system (Millipore Corporation, Bedford, MA, USA).
7
Ceragenin CSA-131 Synthesis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
8
PLGA-PEG Nanoparticles for Levofloxacin Delivery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Poly(lactic-co-glycolic) acid (PLGA)(50:50, MW:15000), polyethylene glycol (PEG) (MW:3500), PLGA-PEG (-COOH) was synthesized by Daigang BIO Engineer Ltd. Co. (Shandong, China). Polyvinyl alcohol (PVA), levofloxacin (LVFX), 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), N-hydroxysuccinimide (NHS), 2,3-bis(2-methoxy-4-nitro-5-sulfo-phenyl)-2H-tetrazolium-5-carboxanilide (XTT), 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT) were purchased from Sigma-Aldrich (St. Louis, MO, USA). 1,1-dioctadecyl-3,3,3ʹ,3ʹ-tetramethylindocarbocyanine perchlorate (DiI), 1,1ʹ-dioctadecyl-3,3,3ʹ,3ʹ-tetramethylindotricarbocyanine iodide (DiR), 2,7-dichlorodihydrofluorescein diacetate (DCFH-DA) were obtained from Beyotime Biotechnology Co., Ltd. (Shanghai, China). Singlet Oxygen Sensor Green (SOSG) was bought from Thermo Fisher Scientific. Middlebrook’s 7H9 broth medium, Oleic acid-albumin-dextrose-catalase (OADC) were purchased from BD biosciences (New York, USA). A LIVE/DEAD BacLightTM Bacterial Viability Kit was acquired from Invitrogen (L7012, Invitrogen, CA, USA). 1,3-diphenylisobenzofuran (DPBF) was obtained from Sigma-Aldrich Chemicals.Aptamer BM2 was purchased by ShengGong BIO Engineer Ltd. Co. (Shanghai, China) with a nucleotide sequence:
(5ʹ-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCCCCCCATGAACTAGGCTCCACAATGAGTTTGGGGGTCAATGCGTCATAGGATCCCGC- 3ʹ).
(5ʹ-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCCCCCCATGAACTAGGCTCCACAATGAGTTTGGGGGTCAATGCGTCATAGGATCCCGC- 3ʹ).
9
Quantifying Microbial Metabolism via XTT Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The XTT assay is a colorimetric cell metabolism test, which estimates the microbial active metabolism by reducing the tetrazolium salt to formazan by dehydrogenase enzymes present in the electron transport system of viable cells. The XTT salt (2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide, Sigma, MO, USA) was prepared in ultra-purified water at the final concentration of 1 mg/mL. The solution was filtered and stored at -80 °C. Menadione solution (Sigma, MO, USA) was prepared in 0.4 mM acetone before the experiment.
At the end of the experimental period, the HA discs were transferred to a falcon tube containing 1 mL of XTT solution (comprised of 158 μL of PBS with 200 mM glucose, 40 μL of XTT and 2 μL of diluted menadione) and the tubes were incubated for 3 h in the dark at 37 °C under anaerobic conditions. After 3 h incubation, 100 μL from each tube was transferred into a 96-well plate and analyzed at 450 nm using a microplate reader (Spectramax ® M5 Microplate, Molecular Devices). Test specimen results were normalized by controls (SH-L-S-) incubated for the same time as treatment groups and expressed as a percentage.
At the end of the experimental period, the HA discs were transferred to a falcon tube containing 1 mL of XTT solution (comprised of 158 μL of PBS with 200 mM glucose, 40 μL of XTT and 2 μL of diluted menadione) and the tubes were incubated for 3 h in the dark at 37 °C under anaerobic conditions. After 3 h incubation, 100 μL from each tube was transferred into a 96-well plate and analyzed at 450 nm using a microplate reader (Spectramax ® M5 Microplate, Molecular Devices). Test specimen results were normalized by controls (SH-L-S-) incubated for the same time as treatment groups and expressed as a percentage.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!