Small interfering rna sirna

The human glioma cell lines (U87, U251, SHG44, A172) were purchased from the American Type Culture Collection (ATCC, Manassas, VA) as well as normal human astrocytes (NHA). Cell were cultured with RPMI‐1640 medium (Gibco, Carlsbad, CA), supplemented with 10% foetal bovine serum (FBS, Gibco, Carlsbad, CA) and 100 U/mL penicillin/streptomycin (Life Technologies, CA) in humidified incubator with 5% CO₂ at 37°C. Small interfering RNA (siRNA) was synthesized by GenePharma Company (Shanghai, China). The transfection of siRNA (si‐LINC00511 and negative controls) was separately transfected into glioma cells using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA). All the sequences were showed in the Table S1.

Human HCT-116 and SW480 CC cell lines (American Type Culture Collection, Manassas, VA, USA) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (FBS; both from Thermo Fisher Scientific Inc., Waltham, MA, USA) with 1% streptomycin and penicillin, at 37°C under a humidified 5% CO₂ atmosphere.
Cells were transiently transfected using Lipofectamine 2000 (Invitrogen) as described by the manufacturer. Small interfering RNA (siRNA) was purchased from GenePharma (Shanghai, China) The sense and anti-sense si-U62317.4 sequences were: 5′-GAAGAGAAGGACAAGUUGACG-3′ and 5′-UCAACUUGUCCUUCUCUUCUG-3′, respectively. We created a stable knockout U62317.4 cell line using short hairpin RNA (shRNA) targeting U62317.4 (sh-U62317.4; General Biosystems, Anhui, China) with the sense and anti-sense sequences, 5′-GATACTTGATCCTGATAAA-3′ and 5′- TTTATCAGGATCAAGTATC-3′, respectively.
Lentiviral particles were obtained as described (16 (link)). HCT-116 cells were directly infected with Polybrene (Santa Cruz Biotechnology, Dallas, TX, USA) for 24 h and then, transfected cells were screened for 7–10 days with 2 μg/mL of puromycin (Invitrogen).

Isoproterenol (ISO) was supplied by Tokyo Chemical Industry Co., Ltd. (Japan). Drugs BEL and Trimetazidine (TMZ) used in the study were obtained from Chengdu Alfa Biotechnology (China) and Nanjing Zenkom Pharmaceutical Co., Ltd. (China), respectively. The staining kits for hematoxylin-eosin (HE) and Masson trichrome were provided by Servicebio Technology Co., Ltd. (China). Collagen I (cat. no.AF7001) and Collagen III (cat. no.AF0136) antibodies were offered by Affinity Biosciences (USA). Primary antibodies for α-SMA (cat. no. ab32575), SOX9 (cat. no. ab185966), Smad3 (cat. no. ab40854), phospho-Smad3 (S423 + S425) (cat. no. ab52903), and TGF-β1 (cat. no. ab92486) were supplied by Abcam Technology (United Kingdom). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, cat. no. 60004-1-Ig) was obtained from Wuhan Proteintech Biotechnology (China). HRP-conjugated antirabbit and antimouse IgG (cat. nos.ZdR-5306 and ZdR-5307) antibodies were offered by Beijing ZSGB Bioengineering Institute (China). DMEM medium was gained from Gibco (USA). The fetal bovine serum (FBS) and penicillin/streptomycin were provided by Biological Industries (Israel). Small interfering RNA (siRNA) was obtained from Shanghai GenePharma (China). Recombinant human TGF-β1 and Lipofectamine^TM 3000 reagents were supplied by Thermo Fisher Scientific (USA).

The Academy of Military Medical Sciences (Beijing, China) provided the human NSCLC cell line A549 and H1299. In a 5% CO₂ humidified incubator at 37°C and RPMI 1640 medium (Thermo Scientific, USA) supplemented with 10% fetal calf serum (FCS) (Thermo Scientific), these cells were cultured. For transfections, pcDNA3.1(+)-MRUL and pcDNA3.1(+) vector (DingGuoChangSheng Biotechnology Co. Ltd., Beijing, China), 50 to 100 nM small interfering RNA (siRNA) (Gene Pharma Co., Shanghai, China), Lipofectamine 2000 (Invitrogen Int., USA), and lentivirus vector-MRUL(−) (RiboBio Co., Guangzhou, China) were employed following the manufacturer's recommendations as portrayed earlier (19). siRNA sequences are presented here: siRNA targeting NR_024549 (MRUL), siMRUL-1, GGCCUUUGUUUGCAGUUUATT; siMRUL-2, AACACUUUCCUGUUUUGGGUC; siMRUL-3, AGUUUCUACUGUUACUGUGUC; siP-gp (targeting P-gp), GGGACAGGAAUAAUUAUAUTT; and siNC (negative control), UUCUCCGAACGUGUCACGUTT.