A full-length RSU1 cDNA was cloned from a human Kidney cDNA library (Clontech) by PCR using the following primers: 5ʹ-gcgaattcatgtccaagtctctgaagaagttggtg-3ʹ and 5ʹ-cggtcgacttatctgttcttggctgccaggggtttcc-3ʹ. The sequence of the RSU1 cDNA was confirmed by automated DNA sequencing. The RSU1 cDNA was inserted into the pGBKT7 vector (Clontech). The pGBKT7/RSU1 construct was used as bait to screen a human keratinocyte MATCHMAKER cDNA library following a previously described protocol (24 (link), 64 (link), 65 (link)). Six positive plasmids containing cDNA inserts with an identical size (1.1 kb) were selected and sequenced. They contain an identical cDNA fragment encoding the C-terminal fragment of PHB2 (residues 101–299). The full-length PHB2 cDNA was isolated from the human lung cDNA library by PCR using the following primers: 5ʹ-gctgaattcatggcccagaacttgaaggacttgg-3ʹ and 5ʹ-gagctcgagtcatttcttacccttgatgaggctg-3ʹ.
Human kidney cdna library
Manufactured by Takara Bio
Sourced in United States, France
The human kidney cDNA library is a collection of complementary DNA (cDNA) molecules derived from the mRNA transcripts of genes expressed in human kidney cells. This library serves as a resource for the study of kidney-specific gene expression and function.
Automatically generated - may contain errors
Lab products found in correlation
Pgbkt7 vector, by Takara Bio (1 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Silencer select validated sirna, by Thermo Fisher Scientific (1 mentions)
Lipofectamine, by Thermo Fisher Scientific (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Pgex 6p 1, by GE Healthcare (1 mentions)
Ceq 8800 genetic analysis system, by Beckman Coulter (1 mentions)
Pcdna3 vector, by Thermo Fisher Scientific (1 mentions)
Pgex 6p1 vectors, by GE Healthcare (1 mentions)
Glutathione agarose beads, by GE Healthcare (1 mentions)
6 protocols using human kidney cdna library
1
Cloning and Characterization of PHB2
2
Regulation of TLR4 signaling by PRSS8
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HepG2 and HEK293 cells were purchased from ATCC and maintained in Dulbecco’s modified Eagle medium containing 10% fetal bovine serum. For gene-silencing experiments, HepG2 cells were transfected with human PRSS8 siRNA (Silencer Select Validated siRNA, ID: s11274, Ambion), human TLR4 siRNA (ID: s14194) or control siRNA (ID: 4390844) using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions. For heterologous expression experiments, cDNA for human PRSS8 (accession code NM-002773, NCBI Reference Sequence Database) was isolated from a human kidney cDNA library (Clontech) by PCR and subcloned into the pcDNA3.1 vector (Invitrogen). cDNA for human MD-2 (pUNO1-hMD2a) and HA-tagged human TLR4 (HA-TLR4) (pUNO-hTLR04a-HA3x) was purchased from InvivoGen. HEK293 cells were transfected with human PRSS8, human MD-2 or human HA-TLR4 using Lipofectamine (Invitrogen) according to the manufacturer’s protocol.
3
Cloning and Mutagenesis of ERRγ
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As previously reported [24] (link), wild-type ERRγ-LBD encoding 222-458 residues was generated by PCR using a human kidney cDNA library (Clontech Laboratories, Mountain View, CA, USA) and cloned into the vector pGEX-6p-1 (GE Healthcare Life Sciences, Piscataway, NJ, USA) using the EcoRI and XhoI restriction enzyme sites. Full-length ERRγ was cloned into the vector pcDNA3.1(+) (Invitrogen, Carlsbad, CA, USA). The resulting plasmids were designated as pGEX-ERRγ-LBD and pcDNA3.1-ERRγ-Full, respectively.
A series of ERRγ mutants were prepared according to the manufacturer's instructions by using PfuTurbo DNA Polymerase (Stratagene, La Jolla, CA, USA) with pGEX-ERRγ-LBD or pcDNA3.1-ERRγ-Full as a template and a set of overlapping sense and antisense primer pairs. The mutations were introduced by PCR mutagenesis in a two-step reaction essentially as reported previously [24] (link), [25] (link). Each mutant LBD or full-length ERRγ was amplified and cloned into the expression vector pGEX-6p-1 or pcDNA3.1(+) at the EcoRI and XhoI sites. The accuracy of all PCR product sequences was confirmed by using a CEQ™ 8800 Genetic Analysis System (Beckman Coulter, Fullerton, CA, USA).
A series of ERRγ mutants were prepared according to the manufacturer's instructions by using PfuTurbo DNA Polymerase (Stratagene, La Jolla, CA, USA) with pGEX-ERRγ-LBD or pcDNA3.1-ERRγ-Full as a template and a set of overlapping sense and antisense primer pairs. The mutations were introduced by PCR mutagenesis in a two-step reaction essentially as reported previously [24] (link), [25] (link). Each mutant LBD or full-length ERRγ was amplified and cloned into the expression vector pGEX-6p-1 or pcDNA3.1(+) at the EcoRI and XhoI sites. The accuracy of all PCR product sequences was confirmed by using a CEQ™ 8800 Genetic Analysis System (Beckman Coulter, Fullerton, CA, USA).
4
Yeast Two-Hybrid Screening for Arl5b Interactors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AH109 yeast cells harboring Arl5b-QL in pGBKT7 vector were mated to Y187 yeast cells pre-transformed with human kidney cDNA library (Clontech). The resulting diploid yeast cells were selected on synthetic drop out medium without Trp, Leu, His and Ade. Gal4-activation-domain-fused cDNAs were subsequently extracted from positive yeast clones and identified by DNA sequencing.
5
Cloning and Silencing of SDCCAG3 and IFT88
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids containing full-length SDCCAG3 have been described earlier23 (link). Full-length IFT88 cDNA was isolated from a human kidney cDNA library (Clontech, Saint-Germain-en-Laye, France) and subcloned into pcDNA3 vectors (Invitrogen, Darmstadt, Germany) containing an N-terminal myc- or EGFP-tag. SDCCAG3 GST-fusion proteins were generated by inserting the indicated sequence fragment into pGEX-6p-1 vectors (GE Healthcare, Munich, Germany).
Allstar negative control siRNA (cat no. 1027280), SDCCAG3 no.1 (cat no.SI04185888) and no.3 siRNA (cat no. SI00713013), mSDCCAG3 siRNA (Cat no. SI04945885) were purchased from Qiagen (Limburg, Netherlands). SDCCAG3 no.2 siRNA and IFT88 siRNA were synthesized from Dharmacon (Thermo Scientific, Waltham, MA, USA) using following sequences: SDCCAG3, r(AAUUCUAAGCUGAGAAGAAUU);mIFT88, r(AAGGCAUUAGAUACUUAUAAA)dTdT; hIFT88, r(CGACUAAGUGCCAGACUCAUU).
Allstar negative control siRNA (cat no. 1027280), SDCCAG3 no.1 (cat no.SI04185888) and no.3 siRNA (cat no. SI00713013), mSDCCAG3 siRNA (Cat no. SI04945885) were purchased from Qiagen (Limburg, Netherlands). SDCCAG3 no.2 siRNA and IFT88 siRNA were synthesized from Dharmacon (Thermo Scientific, Waltham, MA, USA) using following sequences: SDCCAG3, r(AAUUCUAAGCUGAGAAGAAUU);mIFT88, r(AAGGCAUUAGAUACUUAUAAA)dTdT; hIFT88, r(CGACUAAGUGCCAGACUCAUU).
6
Preparation of Recombinant Protein Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pGEX-PLK1 PBD [345–603] was previously described50 (link). pGEX- BICD2 [1–271] and pGEX-BICD2 [272-540] were obtained by subcloning the corresponding cDNAs, amplified by PCR using Pfu Ultra HF DNA polymerase and pEGFP-C2-BICD2 as a template, into empty pGEX-4T1. pGEX-BICD2 [272–540; T319A, S320A, T321A] mutant was produced using QuickChange Lighting Site-Directed Mutagenesis kit according to the manufacturer’s instructions with the primers described above. Proteins were expressed in Escherichia coli BL21(DE3) pLysS cells and purified using glutathione agarose beads (GE Healthcare) according to the manufacturer’s instructions. BICD2 fragments were eluted with 10 mM reduced l -glutathione (Merck Life Science). PLK1 PBD was kept bound to the agarose and stored at 4 °C for subsequent pull-down experiments.
pGEX-Rab6A, containing the cDNA of human Rab6A, was a gift from Anna Akhmanova (Utrecht University) and is described in ref. 17 (link). RanBP2 BBD (residues 2147–2287) was cloned from a human kidney cDNA library (Clontech) and inserted into the PGEX 4T1 vector. Both proteins were expressed in E. coli Rosetta cells and purified using glutathione (GSH) agarose beads as above. Proteins were kept bound to the agarose and stored at −20 °C in 50% glycerol for subsequent pull-down experiments.
pGEX-Rab6A, containing the cDNA of human Rab6A, was a gift from Anna Akhmanova (Utrecht University) and is described in ref. 17 (link). RanBP2 BBD (residues 2147–2287) was cloned from a human kidney cDNA library (Clontech) and inserted into the PGEX 4T1 vector. Both proteins were expressed in E. coli Rosetta cells and purified using glutathione (GSH) agarose beads as above. Proteins were kept bound to the agarose and stored at −20 °C in 50% glycerol for subsequent pull-down experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!