In order to determine specific inhibition of PmRab11 expression, injection of dsRNA-PmRab11 was performed. Shrimps were injected in the muscle with 1.25 or 2.5 μg/g shrimp of dsRNA-PmRab11. Injection of unrelated dsRNA-GFP and 150 mM NaCl were used as controls. Then, hemolymph from individual shrimp was collected at 24, 48 and 72 h post-dsRNA or NaCl injection and mixed with anticoagulants I (27 mM sodium citrate, 34.33 mM NaCl, 104.5 mM glucose, 198.17 mM EDTA, pH 7.0) in a ratio 1:1. Total RNAs was extracted from hemolymph by TRI REAGENT® LS (Molecular Research Center). Semi-quantitative RT-PCR was performed to monitor the levels of PmRab11 expression using PmRab11 specific primers. In addition, to examine the specificity of the knockdown effect of PmRab11, these cDNAs were used as templates for detection of other Rab genes expression using PmRab5 and PmRab7 specific primers (Table 1 ) [11] , [12] .
Tri reagent ls
Manufactured by Molecular Research Center
Sourced in United States
Tri Reagent-LS is a single-step total RNA isolation reagent that can be used to isolate high-quality total RNA from a variety of biological samples, including cells, tissues, and body fluids. The reagent is designed to effectively lyse the samples and separate the RNA from DNA and proteins.
Automatically generated - may contain errors
Lab products found in correlation
Diethyl pyrocarbonate, by Merck Group (2 mentions)
Chelex 100, by Merck Group (2 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Proteinase inhibitor cocktail, by Merck Group (2 mentions)
Antibodies specific for hpnpase and hgapdh, by Abnova (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Revertra ace qpcr rt master mix, by Toyobo (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Tri reagent, by Molecular Research Center (2 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (2 mentions)
Rnase free dnase 1 set, by Roche (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Whatman, by Cytiva (1 mentions)
Nanophotometer, by Implen (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
Rq1 rnase free dnase 1, by Promega (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Minelute gel extraction kit, by Qiagen (1 mentions)
Phosphate buffered saline (pbs), by Merck Group (1 mentions)
Isopropanol, by Merck Group (1 mentions)
22 protocols using tri reagent ls
1
Quantifying PmRab11 Expression Knockdown
2
RNA Extraction from Brain Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Brain impressions were performed directly on FTA Whatman cards, a support dedicated to the storage and preservation of RNA [24 (link)]. Prior to use, the cards were stored at room temperature in a sealed plastic bag in a dry and clean area. The samples were prepared by diluting a small section (approximately 0.1 g) of the brain in 1 ml PBS (10%). After thorough mixing, the brain homogenate was loaded onto the card with a pipette until the sample indicator circle on the filter was covered. The cards were then dried 24 hours at room temperature before being put separately in transparent plastic bags for transportation.
To prepare the samples on FTA Whatman filter paper, 1 cm2 was cut-off from the area containing the brain impression and incubated during 1 hour in Tri-Reagent LS (Molecular Research Center, Cincinnati, Ohio, USA) or overnight in cell culture medium (DMEM) (Life Technologies, Saint Aubin, France), then placed in Tri-Reagent. To obtain viral RNA directly from the Anigen test strip, the cassettes were opened, the filter paper was removed and the area where the sample was deposited was collected and placed into 1 mL of Tri-Reagent LS. For both FTA and Anigen test supports, total RNA extraction was performed as previously described, following manufacturer recommendations [25 (link)].
To prepare the samples on FTA Whatman filter paper, 1 cm2 was cut-off from the area containing the brain impression and incubated during 1 hour in Tri-Reagent LS (Molecular Research Center, Cincinnati, Ohio, USA) or overnight in cell culture medium (DMEM) (Life Technologies, Saint Aubin, France), then placed in Tri-Reagent. To obtain viral RNA directly from the Anigen test strip, the cassettes were opened, the filter paper was removed and the area where the sample was deposited was collected and placed into 1 mL of Tri-Reagent LS. For both FTA and Anigen test supports, total RNA extraction was performed as previously described, following manufacturer recommendations [25 (link)].
3
Isolation and Purification of Total Cellular RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 24 h of treatment, total cellular RNA was extracted from HepG2 cells using Tri-Reagent® LS (Molecular Research Center, USA). Electrophoresis of RNA was carried out by using 1% (w/v) denaturing agarose-bleach gel to check the integrity of isolated RNA. The concentration of isolated total cellular RNA was measured using NanoPhotometer (Implen, Germany). RNA purity was also checked by measuring optical density at 260 nm and 280 nm. DNase treatment was carried out by using RQ1 RNase-Free DNase (Promega, USA).
4
Mitochondrial and Cytoplasmic RNA Purification
5
Total RNA Extraction and RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRI Reagent LS (Molecular Research Center Inc., Cincinnati, OH), followed by treatment with RQ1 RNase-free DNase I (Promega, Madison, WI). RT was performed using SuperScript II (Thermo Fisher Scientific Inc.) with random hexamers, as previously described [24 (link)].
6
Cellular Oxidative Stress Analysis
7
Extraction and Purification of dsRNA from Stool
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of dsRNA was performed at the MRC-DPRU and involved a method previously described by Nyaga et al. (2018)53 (link). Briefly, a 100 mg stool sample was added to 200 µL freshly made phosphate buffered saline (PBS) (Sigma-Aldrich, Germany). A 900 µL volume of TRI-REAGENT-LS (Molecular Research Center, Inc, Cincinnati, OH, USA) was added to the suspended stool sample to homogenize as well as lyse the cells and cell components. A volume of 300 µL chloroform (Sigma-Aldrich, Germany) was then added and centrifugation (13,000 rpm for 20 min at 4 °C) was done in a temperature-controlled microcentrifuge (Eppendorf centrifuge 5427R, Hamburg, Germany). The supernatant containing the total RNA was precipitated by addition of 700 µL isopropanol (Sigma-Aldrich, Germany) and by centrifugation at 16,000×g for 30 min at room temperature. The resulting pellet was re-dissolved by addition of 90 µL of ddH20 (Merck KGaA, Germany). A concentration of 8 M LiCl2 (Sigma, St. Louis, MO, USA) was used to remove ssRNA through precipitation for 16 h after which further centrifugation was done for 30 min at 16,000×g. The extracted dsRNA was purified by utilizing the MinElute gel extraction kit (Qiagen, Hilden, Germany) and the integrity and enrichment of the dsRNA was verified via agarose gel electrophoresis.
8
Evaluating Antiviral Efficacy of Black Tea
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Virus added in saliva was mixed with equal volume of black tea or distilled water for 10 s, followed by an immediate dilution 1000-fold as above. One hundred μL of the mixture was added to the cells in 24-well-plates, and 1 h later supernatant was replaced by 500 μL of fresh culture medium. After culture for 10 h, RNA was extracted from culture supernatant and from cells using TRI Reagent® LS (Molecular Research Center, Inc., Montgomery Road, Cincinnati, OH, USA). After reverse-transcription using ReverTra Ace® qPCR RT Master Mix (Toyobo, Shiga, Japan), cDNA was subjected to real-time PCR using a Step-One Plus Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) and the following primers/probes specific for viral N gene: Forward primer, 5′-AAATTTTGGGGACCAGGAAC-3′; reverse primer, 5′-TGG-CAGCTGTGTAGGTCAAC-3′; and probe, 5′-(FAM) ATGTCGCGCATTGGCATGGA (BHQ)-3′.
9
Extraction and Purification of dsRNA from Stool
10
Transcriptional Analysis of Bacterial Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pto DC3000, Pph 1448A and Psv NCPPB 3335 carrying plasmids pJB3Tc19 and pJBpleD* were grown until OD600 of 0.5 in LB medium supplemented with the appropriate antibiotics at 20°C. Cells were induced in MMF by 3 hours at 20°C. Then, cells were pelleted and processed for RNA isolation using TRI Reagent LS (Molecular Research Center, Cincinnati, OH, USA) according to the manufacturer’s instructions, except that the TRI Reagent was preheated at 70°C and the lysis step was carried out at 65°C. The RNA obtained was treated with TURBO DNA-free™-Kit (Applied Biosystems; California, USA). RNA concentration was determined spectrophotometrically and its integrity was assessed by agarose gel electrophoresis.
DNA-free total RNA (1 µg) was retrotranscribed to cDNA with the iScript cDNA synthesis kit (BioRad; California, USA) using random hexamers. The specific primer pairs used to amplify cDNA are shown inTable S1 . Primer efficiency, qRT-PCR’s and confirmation of the specificity of the amplification reactions were performed as described in [27] (link). Relative transcript abundance was calculated using the ΔΔCt method [28] (link). Transcriptional data were normalized to the housekeeping gene gyrA using Bio-Rad i5 software v.2.1. The expression of a given gene relative to gyrA was calculated as previously described in [27] (link).
DNA-free total RNA (1 µg) was retrotranscribed to cDNA with the iScript cDNA synthesis kit (BioRad; California, USA) using random hexamers. The specific primer pairs used to amplify cDNA are shown in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!