SUM149 and SUM190 cell lines were transfected using the Nucleofector II system (Lonza) with pSpCas9(BB)-2A-GFP (PX458), which was a gift from Feng Zhang (Addgene plasmid # 48138), containing the target sequence AGGAAGACTATGATCGACTG against RhoC. Two days after transfection, single cells were sorted for GFP expression into 96 well plates. Following clonal expansion, genomic DNA was isolated and clones were screened for RhoC mutations using SURVEYOR reactions (IDT) with the following primer pair: Forward-CTGTCTTTGCTTCATTCTCCCT and Reverse-CCAGAGCAGTCTTAGAAGCCAT. Positive clones were sequenced to identify specific mutational events and immunoblotted for RhoC and RhoA.
Nucleofector 2 system
Manufactured by Lonza
Sourced in United States
The Nucleofector II system is a laboratory equipment designed for the efficient transfection of a wide range of cell types, including difficult-to-transfect cells. It utilizes an optimized electrical pulse to deliver nucleic acids directly into the cell nucleus, enabling high transfection efficiency.
Automatically generated - may contain errors
Lab products found in correlation
Pspcas9 bb 2a gfp, by Lonza (1 mentions)
On targetplus control pool, by Horizon Discovery (1 mentions)
Pre mir mirna negative non targeting control 1, by Thermo Fisher Scientific (1 mentions)
96w1e ecis arrays, by Applied Biophysics (1 mentions)
Countess, by Thermo Fisher Scientific (1 mentions)
Nucleofector kit 5, by Lonza (1 mentions)
On targetplus, by Horizon Discovery (1 mentions)
Control sirna, by Horizon Discovery (1 mentions)
35 mm 1 glass bottom dishes, by MatTek (1 mentions)
Pmaxgfp, by Lonza (1 mentions)
Nt sirna, by Horizon Discovery (1 mentions)
Amaxa mouse neuron nucleofector kit, by Lonza (1 mentions)
16 protocols using nucleofector 2 system
1
Genome-edited RhoC knockout cell lines
2
Modulation of DEPTOR and miRNAs in Multiple Myeloma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lines were transfected using the nucleofector II system (Lonza, Allendale, NJ, USA) with the following programs: C-16 for H929 and JJN3, G-16 for MM1S, and X-005 for U266. Cells were transfected with on-TARGET plus™ control pool or on-TARGET plus SMART pool Human DEPTOR (Dharmacon, Lafayette, CO, USA); pre-miR™ miRNA precursors pre-miR-135b, pre-miR-642a, and pre-miR™ miRNA negative non-targeting control#1 (Ambion, Austin, TX, USA); and microRNA inhibitors, hsa-miR-135b-5p miRCURY LNA™ microRNA inhibitor, hsa-miR-642a-5p miRCURY LNA™ microRNA inhibitor, and miRCURY LNA™ microRNA inhibitor negative control A (Exiqon, Woburn, MA, USA). Small interfering RNA (siRNA) and miRNA concentration of 25 nM was used in all the experiments.
3
HUVEC and HDMEC Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HUVEC and HDMEC were routinely grown in EGM2-MV in 1.5% gelatin-coated culture dishes. For all studies, passage 1–5 cells were used. For transfection, cells grown to 80% confluence were trypsinized and pelleted, and 5 X 105 cells were resuspended in 100 μl electroporation master mix containing either 2 μg plasmids or 2 μM siRNA. This mixture was transferred to a cuvette for transfection using a Nucleofector II system (Lonza, Basel, Switzerland) with program A-034 (HUVEC) or M-003 (HDMEC). Warm EGM2-MV (500 μl) was added into the cuvette immediately after electroporation. Cells were later distributed evenly onto gelatin-coated 35-mm dishes for protein extraction, gelatin-coated MatTek 35-mm #1 glass bottom dishes for time-lapse microscopy, or 96W1E ECIS arrays (Applied Biophysics, Troy, NY) for determination of barrier function.
4
Transfection of HUVEC with Rnd3 and Actin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transfected with plasmids encoding MAT‐FLAG‐Rnd3, mCherry‐Rnd3, GFP‐Actin, GFP, or with no vector (mock transfection) using the Nucleofector™ II System (Lonza) according to the manufacturer's instructions. Briefly, HUVEC grown to 80% to 90% confluence in EGM‐2 were trypsinized, and washed with PBS. The number of cells was counted, the suspension was centrifuged at 100g for 10 minutes, and the pellet was resuspended in HUVEC Nucleofector solution (Lonza) at 5×106 cells/mL. Plasmid DNA (2 μg) was added to 100 μL of the cell suspension, and the mixture was transferred into a cuvette for nucleofection. Immediately after nucleofection, 500 μL of prewarmed EGM‐2MV was added to the cuvette, and after a 15‐minute incubation at 37°C, the cells were seeded into either 35‐mm culture dishes, electrode arrays, or Transwell plates for study. Medium was changed 4 to 6 hours posttransfection. Cells were used for study at 1 to 2 days posttransfection. Expression of fluorescent proteins was confirmed using a microscope with appropriate epifluorescent illumination. Expression of MAT‐FLAG‐Rnd3 was confirmed by Western blotting and immunofluorescence labeling.
5
Cloning and Transfection of AP2XII-4 in Toxoplasma
6
Transfection of SKOV3 cells for functional analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All cells were transfected with a Nucleofector II system from Lonza (Allendale, NJ) using the provided transfection protocol for SKOV3 cells as published previously [8 (link), 15 (link)]. SKOV3.ip cells were trypsinized and counted using a Countess automated cell counter (Life Technologies). 2 × 106 cells per transfection cuvette were transfected with either non-targeting siRNA (100 nM), siRNA targeting Gαi2 (100 nM), Gαi2QL (2 μg) or pcDNA3 vector (2 μg) as indicated. After transfection, the cells were plated on 60 mm plates and allowed to adhere overnight. The following day the media was changed and the cells were allowed to grow until the end of the day. The cells were then were re-plated at a density of 5 × 105 cells per 100 mm plate and allowed to adhere overnight. For stable transfection, SKOV3.ip cells transfected as previously described with shGαi2 or control, nonsense shRNA and selected for the expression of shGαi2 or the nonsense vector with puromycin [9 (link)].
7
Silencing PSMB5 in Embryonic NPCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNA targeting PSMB5 (5′-GCACCAUGAUCUGUGGCUGGGAUAA-3′) was synthesized by Genepharma Corp (Shanghai, China). Gene knockdown efficiency was determined by qPCR and Western blotting. The transfection of siRNA and scramble RNA control (4 μM) was conducted on NPCs from E14 mice with the Nucleofector II system (Lonza, Walkersville, MD).
8
Transfection and Stimulation of Ovarian Cancer Cells
9
CD30 Expression Knockdown by siRNA
10
Targeting PPARγ Expression in Adipocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For small interfering RNA (siRNA) targeting of expression in adipocytes, 3T3L1 cells were plated in 6-well plates at a density of . After 1–2 d, when 90% confluence was achieved, cells were induced to differentiate for 8 d using the MDI differentiation protocol described above. Adipocyte differentiation was confirmed by fixing and staining with Oil Red O. Differentiated cells were trypsinized, washed with PBS, counted and transfected with siRNA duplexes by electroporation using the Nucleofector™ II system (Lonza). The siRNA utilized targeted murine ( and ; Dharmacon ON-TARGETplus™ J-040712-05-0010 and J-040712-05-0010); or a control nontargeting siRNA duplex (Control si-RNA; Dharmacon D-001810-01-20). Each sample representing a single well was electroporated with siRNA cells in a total volume of Nucleofection™ solution in disposable electroporation cuvettes. The samples were removed from the cuvettes using pre-warmed medium MEM with 10% FBS, and replated in 6-well plates in an additional prewarmed media. After 48 h, cells were then treated with ligands for 24 h, total RNA was harvested, and cDNA was prepared and used for quantitative gene expression analysis as described above.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!