PRDM4 ORF cDNA clones were purchased from Origene. The PRDM4 ORF was cloned into pcDNA3.1 and transfected into 3T3-L1 and C3H10T1/2 cells for overexpression of PRDM4. PRDM4 siRNAs were synthesized by Genolution and screened for inhibition efficiency of RRDM4 mRNA expression levels. The selected siRNAs were then transfected using RNAi MAX (Invitrogen). The sequences for si#1 and si#2 are GAAUUACGCUCAACAGAUAUU and GAAAGUGAGCUGCUUUUCUUU, respectively. siRNAs transfected 3T3-L1 or C3H10T1/2 cells at 80% confluence in a concentration of 30nM. Then, the cells differentiated into adipocytes.
Prdm4 orf cdna clones
Manufactured by OriGene
PRDM4 ORF cDNA clones are laboratory tools that contain the full-length open reading frame (ORF) of the PRDM4 gene. PRDM4 is a transcriptional regulator involved in various cellular processes. These clones can be used for expression, purification, and functional studies of the PRDM4 protein.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using prdm4 orf cdna clones
1
PRDM4 Overexpression and Knockdown in Adipogenesis
2
PRDM4 Overexpression and Knockdown in Adipogenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PRDM4 ORF cDNA clones were purchased from Origene. The PRDM4 ORF was cloned into pcDNA3.1 and transfected into 3T3-L1 and C3H10T1/2 cells for overexpression of PRDM4. PRDM4 siRNAs were synthesized by Genolution and screened for inhibition efficiency of RRDM4 mRNA expression levels. The selected siRNAs were then transfected using RNAi MAX (Invitrogen). The sequences for si#1 and si#2 are GAAUUACGCUCAACAGAUAUU and GAAAGUGAGCUGCUUUUCUUU, respectively. siRNAs transfected 3T3-L1 or C3H10T1/2 cells at 80% confluence in a concentration of 30nM. Then, the cells differentiated into adipocytes.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!