Anti chicken alexa fluor 488

Frozen samples were sectioned at 6μm using with the cryostat (Leica Microsystems Inc, Buffalo Grove, IL). To remove endogenous mTomato signal, antigen retrieval was performed by heating the slides in Citra solution (BioGenex, Fremont, CA). The slides were blocked in 5% Normal Donkey Serum (Jackson ImmunoResearch Laboratories, Inc, West Grove, PA) in 5% PBST (phosphate buffered saline with 0.02% Tween-20) at room temperature for 1 hour, then stained with primary antibody diluted in blocking buffer overnight at 4°C. The next day, the slides were washed in PBS 3 x 10min, incubated in secondary antibody in blocking buffer for an hour at room temperature, and washed in PBS 3 x 10min before mounting on ProLong Gold DAPI (Life Technologies). The primary antibodies used were rabbit anti-Keratin 5 (1:1000, Abcam, Cambridge, MA), rat anti-Keratin 8 (1:250, Developmental Studies Hybridoma Bank, Iowa) and chicken anti- GFP (1:1000, Abcam). Anti-Rabbit-Cy3, anti-Chicken-AlexaFluor488, and Alexa Fluor 647-Strepravadin (all from Jackson ImmunoResearch) were used for the secondary antibody for immunofluorescent staining.

Anti-chicken Alexa Fluor® 488 (703-546-155, Jackson ImmunoResearch), anti-mouse Cyanine 3 (115-167-003, Jackson ImmunoResearch), anti-rabbit Cyanine 3 (111-166-045, Jackson ImmunoResearch), anti-mouse DyLight® 649 (715–495-150, Jackson ImmunoResearch), anti-rabbit Cyanine 5 (111-175-144, Jackson ImmunoResearch), anti-digoxigenin TAMRA (11207750910, Roche) (used for FISH).
Primary and secondary antibodies were usually diluted at 1:200.
Centromere-specific oligonucleotide probes were used for the FISH experiments: the a7d probe (5′ ATTGTCCTCAAATCGCTT 3′) targets the D7Z1 α-satellite repeats while the a11G probe (5′ AGGGTTTCAGAGCTGCTC 3′) targets the D11Z1 repeats (nucleotides underlined indicate LNA bases). The a7d oligonucleotide is coupled with digoxigenin and a11G with AF488 fluorophore. The D7Z1 probe used for IF-FISH was generated by random priming, the PCR product used for the reaction was obtained by amplifying U2OS DNA with the following primers: Fwd 5′ ACGGGGTTTCTTCCTTTCAT/Rev 5′ GCTCTCTCTAAAGCAAGGTTCA.

Forty-eight hours after CSDS (see below), mice were anaesthetized with chloral hydrate and transcardially perfused with 0.1M PBS followed by 4% paraformaldehyde in PBS. Brains were postfixed overnight and then cryopreserved in 30% sucrose. Brains were sectioned on a freezing microtome at 35 μm. Sections were rinsed three times in PBS and blocked in 4% normal donkey serum (NDS) with 0.5% Triton-X in PBS (PBST) for 2 h at room temperature. Sections were then incubated in primary antibodies overnight at 4 °C (chicken anti-GFP, #AB13970, Abcam, 1:500 and rabbit anti-Egr1, #4154 S, Cell Signaling, 1:1,000) in PBST. Sections were then washed three times in PBS and incubated with secondary antibodies (donkey anti-rabbit Cy3, donkey anti-chicken Alexa Fluor 488; 1:500, Jackson ImmunoResearch) for 2 h at room temperature. Sections were washed three times in PBS. Hoechst stain (Invitrogen) was added to the final wash for 25 min. Sections were washed one final time before mounting and coverslipping with ProLong Gold (Invitrogen).