Complete HL-5 and defined SIH (-arginine; -lysine) growth media and unlabelled L -arginine and L -lysine were from Formedium. Labelled K8 L -lysine and R6 L -arginine were from Cambridge Isotope Laboratories. Complete EDTA-free protease inhibitor cocktail was from Roche. Turbo DNase was from Ambion. Novex NuPAGE 4–12% gradient bis-tris gels with MOPS SDS running buffer and Novex colloidal blue staining kit were from Invitrogen. Trypsin Gold was from Promega. LavaPep peptide quantification kit was from Gel Company. ZipTip C-18 peptide purification microcolumns and high fidelity KOD hot start DNA polymerase were from Merck Millipore. Restriction enzymes, T4 DNA ligase and Antarctic phosphatase were from New England Biolabs. Plasmid miniprep kit and PCR clean-up kit were from Qiagen. Krypton fluorescent protein stain and Nunc Lab-Tek chambered cover glass plates for cell imaging were from Thermo Scientific. All the other reagents were obtained from Sigma-Aldrich.
High fidelity kod hot start dna polymerase
Manufactured by Merck Group
Sourced in Germany
High fidelity KOD hot start DNA polymerase is a thermostable DNA polymerase enzyme designed for high-accuracy DNA amplification. It exhibits increased fidelity and processivity compared to standard Taq DNA polymerases.
Automatically generated - may contain errors
Lab products found in correlation
Novex colloidal blue staining kit, by Thermo Fisher Scientific (2 mentions)
Plasmid miniprep kit, by Qiagen (2 mentions)
Complete hl 5 and defined sih arginine lysine growth media, by Formedium (2 mentions)
Unlabelled l arginine, by Formedium (2 mentions)
L lysine, by Formedium (2 mentions)
Labelled k8 l lysine, by Cambridge Isotopes (2 mentions)
R6 l arginine, by Cambridge Isotopes (2 mentions)
Novex nupage 4 12 gradient bis tris gels with mops sds running buffer, by Thermo Fisher Scientific (2 mentions)
Ziptip c 18 peptide purification microcolumns, by Merck Group (2 mentions)
Krypton fluorescent protein stain, by Thermo Fisher Scientific (2 mentions)
Nunc lab tek chambered cover glass plates for cell imaging, by Thermo Fisher Scientific (2 mentions)
Pcr cleanup kit, by Qiagen (2 mentions)
Antarctic phosphatase, by New England Biolabs (2 mentions)
Trypsin gold, by Promega (2 mentions)
Turbo dnase, by Thermo Fisher Scientific (2 mentions)
Complete edta free protease inhibitor cocktail, by Roche (1 mentions)
Complete edta free protease inhibitors cocktail, by Roche (1 mentions)
Dual luciferase reporter assay kit, by Promega (1 mentions)
Fastgene optima hotstart ready mix, by Nippon Genetics (1 mentions)
Pcrii plasmid, by Thermo Fisher Scientific (1 mentions)
4 protocols using high fidelity kod hot start dna polymerase
1
Proteome Analysis of SIH Cell Lines
2
Quantitative Mass Spectrometry Proteomics
3
Measuring SARS-CoV-2 Frameshift Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The −1 PRF sequence from SARS-CoV-2 was inserted between the coding sequences of renilla luciferase (Rluc) and firefly luciferase (Fluc) to generate a pDual-SARS-CoV-2 plasmid (−1, WT). For the in-frame control reporter pDual-SARS-CoV-2 (0, Ctrl), an additional cytosine was inserted immediately after the silent mutated slippery sequence such that Fluc and Rluc were in the same reading frame (denoted as “0”)41 (link). The 33 nt sequence (GGTTATGGCTGTAGTTGTGATCAACTCCGCGAA) that could form a duplex with the Stem 1 region of FSE-PK were deleted by PCR using KOD hot-start high fidelity DNA polymerase (Merck Millipore, 71086) with primers shown in Supplementary Table 1 . Frameshifting efficiency was measured by transient transfection of the Dual-Luciferase Reporter plasmids into 293T cells (ATCC, CRL-3216) using Lipofectamine 2000 as previously described77 (link). 293T cells were seeded in a 6-well plate at a density of 30%. On the following day, 0.2 μg of each plasmid were individually transfected into cells and allowed for further incubation of 24 h in a 5% CO2 incubator. Luciferase activity was measured using a Dual-Luciferase Reporter Assay Kit by following the manufacturer’s instructions (Promega, E1910). We quantified the frameshifting efficiency by normalizing WT and Del values to their in-frame controls as previously described78 (link).
4
Genotyping of Knock-In Mouse Alleles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping was performed by PCR using primer pairs that flanked the homology arms of the knock-in DNA sequences and FastGene Optima HotStart ReadyMix (Nippon Genetics, Tokyo, Japan). PCR conditions were optimized for each allele by gradient PCR. Sequences of genotyping primers are shown in Supplementary Material, Table S4 . PCR genotyping of NexCre and R26cBirA alleles was performed as previously described [24 (link),25 (link)]. For Sanger sequencing, PCR was performed using KOD Hot Start high-fidelity DNA polymerase (Merck, Darmstadt, Germany) and the knock-in-allele-containing bands were extracted from agarose gels, cloned into a pCRII plasmid (Invitrogen, Waltham, MA, USA), and sequenced at Eurofins Genomics (Ebersberg, Germany).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!