Plko tet on vector

pLKO Tet-On vectors expressing shRNAs against HELLS and lncRNA BlackMamba were generated by cloning synthetic double-stranded oligonucleotides into pLKO Tet-On vector (Addgene #21915). Vectors were packaged into lentiviral particles HEK 293T-cell line and used for infection of low passages MAC2A or TLBR-2 at multiplicity of infection. Cells were selected with 0.5 or 1 μg/ml of puromycin (MAC2A and TLBR-2 respectively) for 3 days.
The list of shRNAs sequences is provided in Supplementary Table 1.

Stable cell lines were generated using retroviral or lentiviral plasmid vectors. Briefly, concentrated viral supernatants were applied to target cells with 6 μg/ml protamine sulphate. Infected cells were then selected for with puromycin or blasticidin. TWIST1 and SNAIL1 cDNAs were cloned into the pWZL-Blast vector. The shRNAs targeting GFP (5′-CGTGATCTTCACCGACAAGAT-3′) and POSTN (#2: 5′-CGGTGACAGTATAACAGTAAA-3′ (exon 8), #4: 5′-GCAGAGAAATCCCTCCATGAA-3′ (exon 11)) were cloned into the pLKO-Tet-On vector (Addgene).

Lentiviral constructs were transfected with VSVG and Δ8.9 (packaging) to HEK293T cells using FuGENE6 (Promega, E2692). The viral supernatant was then concentrated using Lenti-X (TaKaRa, 631232) and transduced into recipient cells with 8 μg/mL polybrene. After transduction, the infected cells were selected with puromycin for 2 days. Knockdown experiments used pLKO-Tet-On vector (Addgene, 21915). In total, 1 μg/mL doxycycline (DOX) was used to induce knockdown. RNA was extracted on day 5 for qPCR (Supplemental Table 8). The following shRNAs sequences were used. shAHCY, 5′-CACAGGCTGTATTGACATCAT-3′; shPPAT, 5′-CAATACCATCTCACCTATAAT-3′; shGCSH, 5′-GTGAACTCTATTCTCCTTTAT-3′. Control (Renilla), 5′-TAGATAAGCATTATAATTCCT-3′.

DNA plasmids for lentiviral vectors with doxycycline-inducible human YAP1 and YAP1-5SA cDNAs were generated by VectorBuilder, Inc.. Plasmids were designed using VectorBuilder website tools. In brief, human YAP1 plasmid was designed using an mRNA sequence from NCBI transcript NM_001282101, and human YAP1-5SA was designed based on ref. ^{82 (link)} to generate an unphosphorylated CA form of YAP1. Both WT and mutant YAP1 plasmids are driven by a TRE3G promoter and have a CMV-puromycin-T2A-mCherry cassette inserted after the gene of interest to facilitate the selection of transfected cells. Target cells were coinfected with a lentivirus expressing Tet-On 3G transactivator protein and hygromycin resistance (VectorBuilder, VB160122 -10094).
YAP short hairpin (sh)RNA lentiviral expression vectors were cloned by ligating oligonucleotides encoding the shRNA hairpins (Integrated DNA Technologies) into the pLKO-Tet-On vector (Addgene #21915) to have temporal control of YAP1 KD (oligonucleotide sequences are listed in file Supplementary Data 1). All plasmids were validated using restriction enzymes and Sanger sequencing (Macrogen) using the primer pLKO-shRNAseq (ggcagggatattcaccattatcgtttcaga).

To generate shRNA-expressing plasmids, the double-stranded oligonucleotides encoding the desired shRNA were cloned into the AgeI and EcoRI restriction sites of pLKO-Tet-On vector (Addgene, Inc., Cambridge, MA, USA) as described previously (17 (link)). The constructs containing an LC3-specific shRNA sequence 5′-CTGAGATCGATCAGTTCAT-3′; and scrambled shRNA 5′-GCAAGCTGACCCTGAAGTTCAT-3′ were designated pLKO-Tet-shLC3 and pLKO-Tet-shCon, respectively.