Nanodrop 2000 spectrophotometer

Total RNA was extracted with the NucleoSpin RNA kit (Macherey-Nagel). RNA quality was assessed with a NanoDrop 2000 spectrophotometer, and cDNAs were synthesized with the iScript Advanced cDNA synthesis kit (Bio-Rad) and 1 μg of RNA. Real-time PCR was performed with the cDNA template (1/10 dilution), iQ SYBR Green Supermix (Bio-Rad), and 300 nM forward and reverse primers. Amplification was performed with the CFX96 detection system (Bio-Rad). The relative quantities of the MAPT, CDA and BLM cDNAs were normalized against three reference genes (B2M, β-actin and TBP). The primer sequences are provided in Supplementary Table 6.

Reverse transcription and real-time quantitative PCR were performed as previously described [12 (link)]. Total RNA was extracted with the NucleoSpin RNA kit (Macherey–Nagel). RNA quality was assessed with a NanoDrop 2000 spectrophotometer, and cDNAs were synthesized with the iScript Advanced cDNA synthesis kit (Bio-Rad) and 2 μg of RNA. Real-time PCR was performed with the cDNA template (1/20 dilution), iQ SYBR Green Supermix (Bio-Rad), and 300 nM forward and reverse primers. Amplification was performed with the CFX96 detection system (Bio-Rad). The relative quantities of the MAPT and CDA cDNAs were normalized against two reference genes (B2M and TBP) or GAPDH. The primer sequences are provided in Supplementary Material S2.

Microbial DNA was extracted from each of the 24 samples using a FastDNA Spin Kit for soil (MP Biomedicals, Santa Ana, CA, United States), according to the manufacturer's protocols (Sun et al., 2022 (link)). The DNA quality and quantity were determined using a NanoDrop 2000 spectrophotometer (Bio-Rad Laboratories Inc., USA.). The V4–V5 region of the bacteria 16S ribosomal RNA gene and the ITS gene was amplified by PCR (95°C for 5 min, followed by 25 cycles at 95°C for 30 s, 30 s at ${\text{T}}_{\text{m}}^{°}$ C, and 72°C for 45 s, and a final extension at 72°C for 10 min and 10°C until halted by user) using the primers 515F 5′-GTGCCAGCMGCCGCGG-3′, 907R 5′-CCGTCAATTCMTTTRAGTTT-3′, ITS1F 5′-CTTGGTCATTTAGAGGAAGTAA-3′, and ITS2R 5′-GCTGCGTTCTTCATCGATGC-3′, where the barcode is an eight-base sequence unique to each sample. The PCR reactions were performed in triplicate in a 20 μl of a mixture containing 4 μl of 5× FastPfu Buffer, 2 μl of 2.5 mM dNTPs, 0.8 μl of each primer (5 μM), 0.4 μl of FastPfu Polymerase, and 10 ng of template DNA. The amplicons were extracted from 2% agarose gels, purified using an AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, AP-GX-4) according to the manufacturer's instructions, and quantified using QuantiFluor™-ST (Promega, US).

Total rice RNA was extracted from dissected tissues of the root, culm, leaf sheath, leaf, and panicle, and purified using the RNAprep Pure Plant Kit (Tiangen, China) in accordance with the manufacturer’s instructions. The concentration, purity, and integrity of extracted RNA were determined using a NanoDrop 2000 spectrophotometer (Bio-Rad, China) and 1% agarose gel electrophoresis. All reverse transcriptions were performed using 1 μg total RNA with SuperScript® III Reverse Transcriptase (Invitrogen, China) employing the oligo(dT) 18 primer in accordance with the manufacturer’s instructions. After cDNA synthesis, all samples were diluted tenfold with sterilized water, and qRT-PCR analysis was performed with the SYBR Supermix Kit (Bio-Rad, China) and the ABI 7500 Sequence Detection System (Thermo Fisher, USA) in accordance with the manufacturer’s instructions. Three replicates were performed and normalized relative expression levels were calculated by the ∆∆C_t method using ACTIN1 as an endogenous control (Livak and Schmittgen 2001 (link)). The primers used are listed in Supplementary Table S2.

Total DNA was extracted from the sediment samples according to the manufacturer’s protocols using the E.Z.N.A.® Soil DNA Kit (Omega Bio-Tek, Norcross, GA, United States). The DNA quality and quantity were determined using a NanoDrop 2000 Spectrophotometer (Bio-Rad Laboratories Inc., United States). The V3-V4 regions of the 16S rRNA genes from each extracted DNA sample were amplified using primers 341F-806R (341F: ACTCCTACGGGAGGCAGCAG; 806R: GGACTACHVGGGTWTCTAAT; Berg et al., 2012 (link)). All PCRs were performed in 15 μl reaction volumes containing 7.5 μl of Phusion ®High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, MA, United States), 1 μl of forward and reverse primers (10 μM), 1 μl of dNTPs (2.5 mM), and 1 μl template DNA. Thermal cycling comprised initial denaturation at 95°C for 2 min, followed by 25 cycles of denaturation at 94°C for 5 s, annealing at 55°C for 30 s, and elongation at 72°C for 30 s. PCR products from each sample were detected by electrophoresis on a 1.5% agarose gel. The obtained PCR products were purified, quantified, and mixed in equal amounts to construct sequencing libraries. Library quality was evaluated using an Agilent Bioanalyzer 2100 system and a Qubit @2.0 Fluorometer (Thermo Scientific). Finally, the Illumina NovaSeq 6000 platform (San Diego, CA, United States) was used to sequence the libraries using the 250 bp paired-end strategy.

Total RNA was extracted from 2.5 × 10⁵ cells with Total RNA Purification Kit (Norgen, Cat#37500), with modified elution volume of 27µL. RNA concentration was determined using NanoDrop 2000 Spectrophotometer and 1000µg of RNA was used to synthesize complementary DNA (cDNA) using iScript cDNA SuperMix (Bio-Rad, Cat#1708841) and a C1000 Thermo Cycler (Bio-Rad) according to the manufacturer’s guidelines. RT-qPCR analysis was performed with PerfeCTa SybrGreen (Quanta Biosciences, Cat#95054-100) and CFX96 instrument (Bio-Rad). Quantification of gene expression was performed by using CFX manager 3.0 software, with GAPDH as housekeeping gene. The following qPCR primers were used to measure mRNA levels of ITGA5 (FWD 5’-ACCTCTGATGCCTGAGTCCT-3’, REV 5’-AGAAGTACCCAGACCCCTCC-3’ and GAPDH (FWD 5’-TGAACCACCAACTGCTTAGC − 3’, REV 5’-GGCATGGACTGTGGTCATGAG-3’).