Ab272504

Manufactured by GeneTex

Ab272504 is a primary antibody produced by GeneTex. It is designed for use in immunoassays such as Western blot, ELISA, and immunohistochemistry. The antibody targets a specific protein or epitope, but the exact details of the target are not provided in this factual and unbiased description.

Automatically generated - may contain errors

Lab products found in correlation

Prism 8, by GraphPad (2 mentions) Pa5 34929, by GeneTex (2 mentions) Gtx125989, by Abcam (2 mentions) Gtx632269, by GeneTex (2 mentions)

2 protocols using ab272504

Protein and RNA Extraction for SARS-CoV-2 Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction from Trizol
was performed as described previously,^{41 (link)} while protein was extracted from the interphase using isopropanol
precipitation.^{42 (link)} The precipitated protein
was washed in ethanol, resuspended in 5× SDS-PAGE loading buffer,
sonicated for 10 s, and boiled for 10 min before 8% SDS-PAGE analysis.
Western blot was performed using antibodies directed against IAV HA
(Invitrogen, PA5-34929) and NP (GeneTex, GTX125989) and SARS-CoV-2
S (Abcam ab272504) and N (GeneTex, GTX632269). Membranes were washed
in TBS containing 0.1% tween-20. Spike RNA was purchased from IDT
and had the sequence 5′-AGUAGAAACAAGGCGGUAGGCGCUGUCCUUUAUCCAGACAACCAUUACCUGUCCACACAAUCUGCCCUUUCGAAAGAUCCCAACGAAAAGAGAGACCACAUGGUCCUUCCUGCUUUUGCU-3′.
Isolated RNA was reverse-transcribed using SuperScript III and a primer
binding to the 3′ end of the NA segment.^{41 (link)} qPCR was performed as described previously.^{41 (link)} Data was analyzed in Graphpad Prism 8 using
one-way ANOVA with multiple corrections.

Gopal V., Nilsson-Payant B.E., French H., Siegers J.Y., Yung W.S., Hardwick M, & te Velthuis A.J. (2021). Zinc-Embedded Polyamide Fabrics Inactivate SARS-CoV-2 and Influenza A Virus. ACS Applied Materials & Interfaces, 13(26), 30317-30325.

+ Open protocol

+ Expand

SARS-CoV-2 Protein and RNA Detection

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction from Trizol was performed as described previously(36 (link)), while protein was extracted from the interphase using isopropanol precipitation(37 (link)). Precipitated protein was washed in ethanol, resuspended in 5x SDS-PAGE loading buffer, sonicated for 10 seconds, and boiled for 10 min before 8% SDS-PAGE analysis. Western blot was performed using antibodies directed against IAV HA (Invitrogen, PA5–34929) and NP (GeneTex, GTX125989) and SARS-CoV-2 S (Abcam ab272504) and N (GeneTex, GTX632269). Membranes were washed in TBS containing 0.1% tween-20. Spike RNA was purchased from IDT and had the sequence 5 -AGUAGAAACAAGGCGGUAGGCGCUGUCCUUUAUCCAGACAACCAUUACCUGUCCACACAAUCUGCCCUUUCGAAAGAUCCCAACGAAAAGAGAGACCACAUGGUCCUUCCUGCUUUUGCU-3 . Isolated RNA was reverse transcribed using SuperScript III and a primer binding to the 3′ end of the NA segment (36 (link)). qPCR was performed as described previously (36 (link)). Data was analysed in Graphpad Prism 8 using one-way ANOVA with multiple corrections.

Gopal V., Nilsson-Payant B.E., French H., Siegers J.Y., Yung W.S., Hardwick M, & te Velthuis A.J. (2021). Zinc-embedded fabrics inactivate SARS-CoV-2 and influenza A virus. bioRxiv.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!