Oligo dt

Total RNA was extracted with the GenElute™ Mammalian Total RNA Miniprep kit including genomic DNA elimination step using the On-Column DNase I Digestion Set (both Sigma-Aldrich, St. Louis, MO, USA). For all samples, equal amounts of RNA (25 ng of RNA/1 μL of total reaction content) were reverse transcribed into cDNA using M-MLV (Top-Bio, Prague, Czech Republic) and oligo-dT (Qiagen Inc., Valencia, CA, USA) priming. Quantitative PCR was performed in 10 µL reaction volumes using the KAPA SYBR® FAST qPCR Kit (Kapa Biosystems, Wilmington, MA, USA) and 7500 Fast Real-Time PCR System and 7500 Software v.2.0.6 (both Life Technologies, Carlsbad, CA, USA). The expression of individual genes was assessed using at least three technical replicates from three biological replicates of each cell line. The heat shock protein gene HSP90AB1 was used as the endogenous reference control. Following primers (5′→3′) were used for this study: HTR3A (5-hydroxytryptamine receptor 3A) forward—AGGAAGCCAACCACCGTATC; HTR3A reverse—GTCCGTGGGGATGGACAACT; HSP90AB1 (Heat shock protein 90 alpha family class B member 1) forward—CGCATGAAGGAGACACAGAA; HSP90AB1 reverse—TCCCATCAAATTCCTTGAGC.

For RNA kinetic analysis, we used actinomycin D (A9415, Sigma) and assessed α-Syn mRNA expression using qRT-PCR. Briefly, 2 μg of total RNA was reverse transcribed using oligo-dT (79237, Qiagen) and MMLV reverse transcriptase (3201, Beamsbio) according to the manufacturer's instructions. qRT-PCR was performed by monitoring increase in fluorescence in real-time of the SYBR Green dye (MasterMix-R, Abm) using the StepOnePlus^™ Real-time PCR system (Applied Biosystems). RT-PCR was performed using Taq polymerase 2X premix (Solgent) and appropriate primers. PCR primer pairs were as follows: TTP, 5′-CGCTACAAGACTGAGCTAT-3′ and 5′-GAGGTAGAACTTGTGACAGA-3′; α-Syn, 5′-TGTA GGCTCCAAAACCAAGG-3′ and 5′-TGTCAGGAT CCACAGGCATA-3′; Mfn1, 5′-TGTTTTGGTCGCA AACTCTG-3′ and 5′-CTGTCTGCGTACGTCTTCCA-3′; Mfn2, 5′-ATGCATCCCCACTTAAGCAC-3′ and 5′-CCA GAGGGCAGAACTTTGTC-3′; OPA1, 5′-TGTGAGG TCTGCCAGTCTTTA-3′ and 5′-TGTCCTTAATTGG GGTCGTTG-3′; Fis1, 5′-AGGCCGTGCTGAACGAG CTG-3′ and 5′-GGTAGTTCCCCACGGCCAGG-3′; Drp1, 5′-CACCCGGAGACCTCTCATTC-3′ and 5′-CCCCA TTCTTCTGCTTCCAC-3′; GAPDH, 5′-ACATCAAGA AGGTGGTGAAG-3′ and 5′-CTGTTGCTGTA GCCAAATTC-3′. mRNA half-life was calculated from non-linear regression of the mRNA level at 30-, 60-, 90-, and 120-min time points following addition of actinomycin D using GraphPad Prism 5.00 software based on a one-phase exponential decay model.