Isolation of total RNA was performed using TRIzol reagent (Thermo Fisher Scientific, USA) from cultured chondrocytes after 24 hours incubation with IL-1β and OMT, as described by the manufacturer, and quantified using a nanodrop spectrophotometer. Samples with an A260/A280 ratio of ≥1.8 were used. cDNA was generated from 1 μg of total RNA using the PrimeScript RT Master Mix kit (Takara Bio, Japan), followed by qRT-PCR analysis with the SYBR FAST qPCR Master Mix (Takara Bio, Japan), targeting specific genes whose primer sequences are listed in Table 1 , the expression levels of the target genes were calculated using the comparative Ct method.
Sybr fast qpcr master mix
Manufactured by Takara Bio
Sourced in Japan, United States
SYBR FAST qPCR Master Mix is a ready-to-use solution for performing quantitative real-time PCR (qPCR) assays. It contains all the necessary components, including a hot-start DNA polymerase, SYBR Green I dye, and buffer system, to enable rapid and sensitive detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Sybr green real time pcr master mix, by Roche (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
M mlv, by Promega (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
4 protocols using sybr fast qpcr master mix
1
Chondrocyte Gene Expression Analysis
2
BMSC Apoptosis-Related Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BMSCs (1×105/cm2) were seeded into four plates. Subsequently, the cells were collected and total RNA of apoptosis-associated speck-like protein containing a CARD (ASC), NLRP3, caspase-1, thioredoxin-interacting protein (TXNIP) and thioredoxin (TRX) was isolated from the BMSCs using TRIzol® reagent (Thermo Fisher Scientific, Inc.). The SYBR-Green Real-Time PCR Master Mix (KAPA Biosystems; Roche Diagnostics) was used for qPCR, and cDNA synthesis was performed using the PrimeScript RT Reagent kit (Takara Bio, Inc.) in a reaction that included 1 µl cDNA, 0.5 µl forward primer, 0.5 µl reverse primer, 10 µl SYBR FAST qPCR Master Mix and 8 µl ddH2O to a total volume of 20 µl. All reactions were performed according to the manufacturer's protocols. The PCR protocol was as follows: 95°C for 3 min, followed by 40 cycles of 95°C for 5 sec, 56°C for 10 sec, and 72°C for 25 sec. Assays were conducted in triplicate and β-actin served as the reference gene. The primers are shown in Table II . Finally, the values of 2−ΔΔCq reflected the mRNA abundance (27 (link)).
3
Validating Broiler Muscle Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the repeatability and reproducibility of gene expression data obtained by RNA-Seq in breast muscle of broilers, we performed qRT-PCR on 15 randomly selected genes. Total RNA was isolated by TRIzol reagent (Invitrogen). The first-strand cDNA was synthesized with M-MLV (Promega). Gene specific primers were designed according to the gene sequence using primer premier 5.0, which were synthesized by Sangon Biotech (Shanghai, China) (Additional file 2 : Table S2). qRT-PCR was performed using a SYBR Fast qPCR Master Mix (Takara). The reaction mixtures were incubated in a 96-well plate at 95 °C for 20 s, followed by 40 cycles of 95 °C for 3 s and 60 °C for 30 s. All measurements were conducted in triplicates. The chicken glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as an internal control. The 2-ΔΔCt method was used to analyze relative RNA expression.
4
Quantitative RT-PCR Analysis of Inflammatory Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time RT-PCR (qRT-PCR) was used to analyze mRNA expression levels using a CFX96 Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA). These experiments were performed according to a previously described protocol [28 (link)]. Briefly, the reaction consisted of 1 μL of cDNA, 8.2 μL of RNAse-free water, 10 μL of SYBR® Fast qPCR Master Mix (Takara Bio Inc., Mountain View, CA, USA), and 0.4 μL of each gene-specific primer (10 mM). The primer sequences are shown in Table 1 . The relative quantities of each PCR product were determined using the following equation: RQ = 2-ΔΔCT. GAPDH served as an internal control.
Primers used for qRT-PCR analysis
| Primer name | Sequence (5’-3’) | Species |
|---|---|---|
| GAPDH-F | AATGGATTTGGACGCATTGGT | Mouse |
| GAPDH-R | TTTGCACTGGTACGTGTTGAT | |
| IL-6-F | GGCGGATCGGATGTTGTGAT | Mouse |
| IL-6-R | GGACCCCAGACAATCGGTTG | |
| IL-1β-F | GTACATCAGCACCTCACAAG | Mouse |
| IL-1β-R | CACAGGCTCTCTTTGAACAG | |
| TNF-α-F | ACTCCCAGAAAAGCAAGCAA | Mouse |
| TNF-α-R | CGAGCAGGAATGAGAAGAGG | |
| Caspase-3-F | TACCGGTGGAGGCTGACT | Mouse |
| Caspase-3-R | GCTGCAAAGGGACTGGAT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!