Massarray compact system
The MassARRAY Compact System is a laboratory instrument designed for the analysis of nucleic acids. It utilizes mass spectrometry technology to detect and quantify specific genetic sequences. The core function of the system is to provide accurate and reliable data for genetic research and diagnostic applications.
Lab products found in correlation
29 protocols using massarray compact system
DNA Extraction and Genotyping of SDF1 Variants
Quantitative DNA Methylation Analysis
The effectiveness of the entire experimental procedure was assayed by analyzing as control CpGenome Universal Unmethylated DNA (Chemicon) and CpGenome Universal Methylated DNA (Chemicon, Millipore, Germany) in serial mixtures of methylated and unmethylated products, with 10% methylation increments.
Data quality control and filtering were carried out by the removal of the CpG dinucleotides whose the measurement success rate was <80%. Poor‐quality and nonvaluable data for the quantitative methylation of each CpG unit measured by MALDI‐TOF‐MS were excluded.
SSTR-2 Promoter CpG Island Methylation Analysis
Leukocyte Genomic DNA Extraction and Genotyping
MALDI-TOF Genotyping of Genomic DNA
The SNPs were genotyped using matrix-assisted laser desorption/ionization-time of flight-based assay (MALDI-TOF) (23 (link)). The primers were designed using MassARRAY Assay Design software (
Quantitative DNA Methylation Analysis
Quantifying Methylation of PRSS3 Gene
MALDI-TOF MS Genotyping of GP Ia
MALDI-TOF-MS Analysis of Purified Product
Genetic Factors Associated with Intracranial Aneurysm
rs10811661: ACGTTGGATGATAAGCGTTCTTGCCCTGTC (second PCRP), ACGTTGGATGAGATCAGGAGGGTAATAGAC (first PCRP).
rs4977574: ACGTTGGATGGTTTGCTTTCAGGGTACATC (second PCRP), ACGTTGGATGGTTGGTGTTCCAAACAGGAC (first PCRP).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!