The cell lines A549, SH-SY5Y, 293T, THP-1 were obtained from the American-Type Culture Collection (ATCC, Manassas, VA, United States) (Table 1 ). The cell lines H441 and Calu-3 were purchased from Thermo Fisher Scientific (Waltham, MA, United States). The primary human lung microvascular endothelial cells (HMVECs) were obtained from Lonza (Basel, Switzerland). The mouse lung endothelial cell (MLEC) lines were generated in our lab (Wang et al., 2005 (link); Wijelath et al., 2010 (link); Qiu et al., 2013 (link), 2018 (link); Zhang B. et al., 2014 (link)). The cells were cultured in the conditions recommended by the vendors or as reported (Table 1 ).
Calu 3
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Calu-3 is a laboratory equipment product manufactured by Thermo Fisher Scientific. It is a human lung adenocarcinoma cell line used for in vitro research and experimentation purposes.
Automatically generated - may contain errors
Lab products found in correlation
Calu 3, by American Type Culture Collection (9 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (5 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (5 mentions)
Streptomycin, by Thermo Fisher Scientific (5 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (4 mentions)
Beas 2b, by American Type Culture Collection (4 mentions)
Glutamax, by Thermo Fisher Scientific (4 mentions)
Rpmi 1640, by Thermo Fisher Scientific (4 mentions)
Hek293t, by Thermo Fisher Scientific (4 mentions)
Penicillin, by Thermo Fisher Scientific (4 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (3 mentions)
F 12k medium, by Thermo Fisher Scientific (3 mentions)
Calu 3, by Procell (3 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Calu 3, by BNCC (2 mentions)
Cho pgse 606, by American Type Culture Collection (2 mentions)
Cho pgsb 618, by American Type Culture Collection (2 mentions)
Cho pgsd 677, by American Type Culture Collection (2 mentions)
Cho pgsa 745, by American Type Culture Collection (2 mentions)
Caco 2, by American Type Culture Collection (2 mentions)
21 protocols using calu 3
1
Cell Line Culture Protocols Across Disciplines
2
Cultivation of Lung Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human bronchial epithelium (BEAS-2B, cat#: CRL-9609), LUAD cells (A549, cat#: CRM-CCL-185 derived from the lung tissue of a white, 58-year-old male with LUAD; H1975, CRL-5908 derived from the lung tissue of a nonsmoking female with LUAD; and Calu-3, cat#: HTB-55, derived from the lung tissue of a white, 25-year-old male with LUAD) were obtained from the American Type Culture Collection (ATCC), and PC9 (cat#: 90071810, derived from the lung tissue of an undifferentiated patient with LUAD) was obtained from Sigma-Aldrich. Calu-3 (Eagle’s Minimum Essential medium, Thermo Fisher Scientific), PC9 and H1975 (RPMI-1640 Medium, Thermo Fisher Scientific), A549 (F-12K Medium, Thermo Fisher Scientific), and BEAS-2B (BEBM medium, Thermo Fisher Scientific) were cultivated at 37°C with 5% CO2 in medium containing 10% fetal bovine serum (Thermo Fisher Scientific) and 1% penicillin/streptomycin (Thermo Fisher Scientific).
3
Regulation of Lung Cancer Cell Lines by circCDR1as and SOX5
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human lung cancer cell lines (A549, Calu‐3, CAEP and SK‐MES‐1) and human bronchial epithelioid cells (HBE) were purchased from BeNa Culture Collection (Beijing, China) and cultured in Dulbecco's Modified Eagle Medium (DMEM) (Solarbio, Beijing, China) containing 10% fetal bovine serum (Zhejiang Tianhang Biotechnology, Huzhou, China) and 1% penicillin‐streptomycin solution (Procell, Wuhan, China).
The overexpression vectors of circCDR1as and SOX5 were generated with pcDNA3.1 vector (pcDNA) (YouBio, Changsha, China). The pcDNA vector was used as a negative control. The short interfering RNA (siRNA) for circCDR1as (si‐circCDR1as#1, 5′‐GCAAUAUCCAGGGUUUCCGAU‐3′; si‐circCDR1as#2, 5′‐UGUCUGCAAUAUCCAGGGUUU‐3′), siRNA negative control (si‐NC, 5′‐UUCUCCGAACGUGUCACGU‐3′), miR‐219a‐5p mimic (miR‐219a‐5p, 5′‐UGAUUGUCCAAACGCAAUUCU‐3′), mimic negative control (miR‐NC, 5′‐UUCUCCGAACGUGUCACGUTT‐3′), miR‐219a‐5p inhibitor (anti‐miR‐219a‐5p, 5′‐AGAAUUGCGUUUGGACAAUCA‐3′) and inhibitor negative control (anti‐NC, 5′‐CAGUACUUUUGUGUAGUACAA‐3′) were generated by Fulengen (Guangzhou, China). A549 and Calu‐3 cells were transfected with these conducted oligonucleotides or vectors using Lipofectamine 3000 (Thermo Fisher, Wilmington, DE, USA) for 24 hours.
The overexpression vectors of circCDR1as and SOX5 were generated with pcDNA3.1 vector (pcDNA) (YouBio, Changsha, China). The pcDNA vector was used as a negative control. The short interfering RNA (siRNA) for circCDR1as (si‐circCDR1as#1, 5′‐GCAAUAUCCAGGGUUUCCGAU‐3′; si‐circCDR1as#2, 5′‐UGUCUGCAAUAUCCAGGGUUU‐3′), siRNA negative control (si‐NC, 5′‐UUCUCCGAACGUGUCACGU‐3′), miR‐219a‐5p mimic (miR‐219a‐5p, 5′‐UGAUUGUCCAAACGCAAUUCU‐3′), mimic negative control (miR‐NC, 5′‐UUCUCCGAACGUGUCACGUTT‐3′), miR‐219a‐5p inhibitor (anti‐miR‐219a‐5p, 5′‐AGAAUUGCGUUUGGACAAUCA‐3′) and inhibitor negative control (anti‐NC, 5′‐CAGUACUUUUGUGUAGUACAA‐3′) were generated by Fulengen (Guangzhou, China). A549 and Calu‐3 cells were transfected with these conducted oligonucleotides or vectors using Lipofectamine 3000 (Thermo Fisher, Wilmington, DE, USA) for 24 hours.
4
Cell Culture Conditions for Lung Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The H358, Calu‐3, and H1703 were purchased from the American Type Culture Collection (ATCC). The SNU‐1327 were purchased from the Korean Cell Line Bank (Seoul, South Korea). The H358, SNU‐1327, and H1703 cell lines were cultured in Roswell Park Memorial Institute (RPMI) −1640 medium (GE Healthcare) with 10% of fetal bovine serum (FBS) (GE Healthcare) and 1% of penicillin‐streptomycin solution (GE Healthcare). The Calu‐3 cell line was cultured in Eagle's minimum essential medium (EMEM) with 10% of FBS, 1% of penicillin‐streptomycin solution, and 1% of GlutaMAX (Thermo Fisher Scientific) All cell lines were incubated in a humidified incubator at 37°C with 5% of CO2.
5
Establishment of Cell Culture Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Vero cells (# CCL-81), BHK-21 (# CCL-10), Caco-2 (# HTB-37), Calu-3 (# HTB-55), CHO-K1 (# CCL-61), CHO-pgsA-745 (# CRL-2242), CHO-pgsB-618 (# CRL-2241), CHO-pgsD-677 (# CRL-2244), CHO-pgsE-606 (# CRL-2246), HEK293-FT (# CRL-11268), A549 (# CCL-185) and MOLT-4 (# CRL-1582) cells were from the American Type Culture Collection (ATCC). MonoMac-1 cells (# ACC 252) were from the DSMZ-German Collection of Microorganisms and Cell Cultures. PBMCs were obtained from a healthy donor with informed consent, at the Department of Transfusion Medicine (NIH). Vero, BHK-21, Caco-2, Calu-3 and HEK293-FT cells were grown in DMEM with GlutaMAX (Thermo Fisher # 10566016). CHO-K1, CHO-pgsA-745, CHO-pgsB-618, CHO-pgsD-677, CHO-pgsE-606 and A549 cells were grown in F-12K medium (Thermo Fisher # 21127022). PBMCs, MOLT-4 and MonoMac-1 cells were grown in RPMI 1640 (Thermo Fisher # 11875119). BHK-21_hACE2, CHO-K1_hACE2, HEK293-FT_hACE2 and A549_hACE2 cells were grown in their correspondent medium with 250–500 μg/ml of blasticidin (Invivogen # ant-bl-1). All cell media were supplemented with 8% (v/v) not heat inactivated FBS (Hyclone # SH30071.03), but Caco-2 with 20%, and cells were grown cultured at 37° C with 5% CO2 in sterile flasks. Cells were passaged at ~80–90% confluence and seeded as explained for each individual assays.
6
Establishment of Cell Culture Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Vero cells (# CCL-81), BHK-21 (# CCL-10), Caco-2 (# HTB-37), Calu-3 (# HTB-55), CHO-K1 (# CCL-61), CHO-pgsA-745 (# CRL-2242), CHO-pgsB-618 (# CRL-2241), CHO-pgsD-677 (# CRL-2244), CHO-pgsE-606 (# CRL-2246), HEK293-FT (# CRL-11268), A549 (# CCL-185) and MOLT-4 (# CRL-1582) cells were from the American Type Culture Collection (ATCC). MonoMac-1 cells (# ACC 252) were from the DSMZ-German Collection of Microorganisms and Cell Cultures. PBMCs were obtained from a healthy donor with informed consent, at the Department of Transfusion Medicine (NIH). Vero, BHK-21, Caco-2, Calu-3 and HEK293-FT cells were grown in DMEM with GlutaMAX (Thermo Fisher # 10566016). CHO-K1, CHO-pgsA-745, CHO-pgsB-618, CHO-pgsD-677, CHO-pgsE-606 and A549 cells were grown in F-12K medium (Thermo Fisher # 21127022). PBMCs, MOLT-4 and MonoMac-1 cells were grown in RPMI 1640 (Thermo Fisher # 11875119). BHK-21_hACE2, CHO-K1_hACE2, HEK293-FT_hACE2 and A549_hACE2 cells were grown in their correspondent medium with 250–500 μg/ml of blasticidin (Invivogen # ant-bl-1). All cell media were supplemented with 8% (v/v) not heat inactivated FBS (Hyclone # SH30071.03), but Caco-2 with 20%, and cells were grown cultured at 37° C with 5% CO2 in sterile flasks. Cells were passaged at ~80–90% confluence and seeded as explained for each individual assays.
7
SARS-CoV-2 Propagation and Titration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Calu-3 (KCLB Cat# 30055), Caco-2 (KCLB Cat# 30037.1), and Vero cells (KCLB Cat# 10081) were purchased from the Korean Cell Line Bank (Seoul, Korea). SARS-CoV-2 (BetaCoV/Korea/KCDC03/2020, NCCP no. 43326) was obtained from the Korea Disease Control and Prevention Agency (Osong, Korea).
The cells were cultured in the appropriate medium (Calu-3 and Vero cells: Dulbecco’s modified Eagle medium (DMEM; Gibco, Waltham, MA, USA); Caco-2 cell: minimum essential medium Eagle with Earle’s BSS (Lonza, Basel, Switzerland)), supplemented with 10% fetal bovine serum (FBS; Serana, Pessin, Germany) and 1% penicillin/streptomycin (Gibco), and maintained in a 5% CO2 incubator at 37 °C. SARS-CoV-2 (BetaCoV/Korea/KCDC03/2020; GISAID accession ID: EPI_ISL_407193) was propagated in Vero cell and viral titers were determined by plaque assay as described below.
The cells were cultured in the appropriate medium (Calu-3 and Vero cells: Dulbecco’s modified Eagle medium (DMEM; Gibco, Waltham, MA, USA); Caco-2 cell: minimum essential medium Eagle with Earle’s BSS (Lonza, Basel, Switzerland)), supplemented with 10% fetal bovine serum (FBS; Serana, Pessin, Germany) and 1% penicillin/streptomycin (Gibco), and maintained in a 5% CO2 incubator at 37 °C. SARS-CoV-2 (BetaCoV/Korea/KCDC03/2020; GISAID accession ID: EPI_ISL_407193) was propagated in Vero cell and viral titers were determined by plaque assay as described below.
8
Culturing Human Cell Lines for Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human embryonic kidney cell line HEK293T (CRL-3216) and lung adenocarcinoma cells Calu-3 (HTB-55Tm) were purchased from ATCC. Vero-E6-TMPRSS2 cells were purchased from JCRB Cell Bank. Human embryonic kidney cell line HEK293T and Calu-3 cells were cultured in Dulbecco’s modified Eagle medium (DMEM) (Gibco, Life Technologies) supplemented with 10% fetal bovine serum (FBS; Gibco, Life Technologies) and 50 U/mL penicillin-streptomycin (Pen-Strep; Thermo Fisher) at 37°C in a 5% CO2 atmosphere. Vero-E6-TMPRSS2 cells were cultured in DMEM supplemented with 10% FBS, 1% Pen-Strep, and 1 mg/mL G418 [G418 (Geneticin); InvivoGen].
9
Culturing LUAD and Normal Lung Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The LUAD cell lines Calu3, H1299 and H292 and the normal lung epithelial cell line BEAS-2B were purchased from the American Type Culture Collection. BEAS-2B cell line was cultured in BEBM medium (Lonza Group, Ltd.) whereas Calu3, H1299 and H292 cell lines were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (HyClone; GE Healthcare Life Sciences), 100 µg/ml streptomycin and 100 U/ml penicillin (Gibco; Thermo Fisher Scientific, Inc.). All cell lines were placed at 37°C in a humidified incubator containing 5% CO2.
10
Cultivating Lung Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The normal human bronchial epithelial cell line, Beas-2B (Cat#: BNCC338205), and five LAC cell lines, A549 (Cat#: BNCC100215), Calu-3 (Cat#: BNCC338514), H1975 (Cat#: BNCC340345), H460 (Cat#: BNCC339581), and PC9 (Cat#: BNCC340767), were purchased from BeNa Culture Collection (BNCC, China). Dulbecco’s modified Eagle’s minimal essential medium (Gibco, USA) containing 10% fetal bovine serum (FBS) (Gibco, USA) was used to cultivate Beas-2B, Calu-3, and PC9 cells, whereas the Roswell Park Memorial Institute-1640 medium containing 10% FBS (Gibco, USA) was used to cultivate the other cells. All cells were routinely cultured under the same conditions in an incubator containing 5% CO2 at 37°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!