Go script reverse transcriptase cdna synthesis kit

RNeasy mini kit (Qiagen, Hilden, Germany) was used for total RNA extraction from Mtb cultures according to standard protocol (Rastogi et al., 2016 (link)). The reverse transcription of about 1 μg of the total RNA sample was done in a 20 μl reaction using Go Script™ Reverse Transcriptase cDNA Synthesis Kit (Promega, WI, United States). The synthesized cDNA was used directly for qRT-PCR. Primers used are listed in Supplementary Table S3. The specificity of the PCR products was checked by melting curve analysis. SigA gene was used as endogenous control, and results were normalized using the 2^−ΔΔCT method (Livak and Schmittgen, 2001 (link)).

RNA was extracted using the RNeasy kit (Qiagen) according to the manufacturer’s instructions. RNA concentrations were measured using a NanoDrop. The GoScript Reverse Transcriptase cDNA Synthesis kit (Promega) was used to generate cDNA from fibroblasts and cortical neurons using random primers. RNA was mixed with random primers and incubated for 5 min at 70 °C and placed on ice for 5 min. The remaining reaction mix was added and incubated for 5 min at 25 °C, followed by 1 h 42 °C extension period and a 15 min 70 °C inactivation. The GoTaq 2× Mastermix (Promega) was used to amplify novel exon inclusion in HTT, amplifying 0.5 µl of the template with 1 µl of fwd primer (100 µM stock, GTCATTTGCACCTTCCTCCT) and 1 µl rev primer (100 µM stock, TGGATCAAATGCCAGGACAG), 5 µl Mastermix and 2.5 µl DNase/RNase-free water. Primer sequences were obtained from the Novartis patent (WO2021084495A1). The mix was amplified with the following conditions: 95 °C for 3 min, and 34 cycles of 95 °C for 30 s, 60 °C for 20 s, and 72 °C for 60 s. A final extension of 72 °C for 5 min was added at the end. The products were run on a 2% Agarose gel with RotiGel stain. (Carl Roth GmbH) at 125 V. A random selection of 88 bp and ~200 bp bands in Ctrl and HD was cut out and purified to verify their correct identity by Sanger sequencing.