Total RNA was extracted from fresh-frozen tissues and cell lines with TRIzol reagent (Invitrogen). cDNAs were synthesized with OneScript Plus Reverse Transcriptase (abm). Quantitative real-time PCR (qPCR) was performed with the OneScript Plus cDNA Synthesis kit (abm). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal normalization reference. The qPCR primers used are listed as follows: TRIM29 forward: AGCATCAGCGACTCTGTGTTG, TRIM29 reverse: GAAGTTGCCTAGTGACTGTCC; PKM1 forward: TGTACCATTGGCCCAGCTTC, PKM reverse: CAGCCACAGGATGTTCTCGT; GATA2 forward: GCCGGGAGTGTGTCAACTG, GATA2 reverse: AGGTGGTGGTTGTCGTCTGA; GAPDH forward: GAGAAGGCTGGGGCTCATTT, GAPDH reverse: AGTGATGGCATGGACTGTGG.
One script plus reverse transcriptase
Manufactured by Applied Biological Materials
Sourced in Canada
OneScript Plus Reverse Transcriptase is a recombinant reverse transcriptase enzyme designed for efficient and sensitive reverse transcription of RNA to cDNA. The enzyme exhibits strong activity and processivity, enabling the generation of high-quality cDNA from a wide range of RNA templates.
Automatically generated - may contain errors
Lab products found in correlation
Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Onescript plus cdna synthesis kit, by Applied Biological Materials (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Rnase if, by New England Biolabs (1 mentions)
Rnase h, by New England Biolabs (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Brightgreen qpcr mastermix, by Applied Biological Materials (1 mentions)
Novaseq 6000 sequencer, by Illumina (1 mentions)
Labopass gel extraction kit, by Cosmogenetech (1 mentions)
Topcloner ta blunt kit, by Enzynomics (1 mentions)
Accupower taq pcr premix, by Bioneer (1 mentions)
5 protocols using one script plus reverse transcriptase
1
Quantitative Real-Time PCR Analysis
2
Reverse Transcription of RNA Using OneScript Plus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription is carried out with OneScript Plus Reverse Transcriptase (ABM G237) in a 20 μl volume with the following components and final concentrations: 1× Reaction Buffer, dNTPs (0.5 mM), RNAseOUT (2U/μl), RT_4609bp_Gal10pro-F gene specific primer (0.2 μM), RNA input (<5 μg) and OneScript Plus RT (10 U/μl). Primers are initially annealed to template RNA in the presence of dNTPs, by heating to 65°C for 5 min, followed by snap cooling to 4°C for 2 min. After snap cooling, the rest of the components are added, followed by reverse transcription for 1.5 h at 50°C. Reactions are stopped by heat inactivation at 85°C for 5 min. Any residual RNA is digested by adding 1 μl each of RNaseIf (NEB M0233S) and RNAse H (NEB M0297S). Reaction is cleaned with Monarch DNA Clean kit and eluted in 10 μl EB.
3
Two-step RT-PCR for Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRI reagent (Sigma-Aldrich, St. Louis, MO, USA). A Two-step RT-PCR (reverse transcription polymerase chain reaction) was performed using Bright Green qPCR master Mix (Applied Biological Materials, Richmond, BC, Canada) and One Script Plus Reverse Transcriptase with Step One Plus Real Time Machine (Applied Biological Materials, Richmond, BC, Canada) RNA samples were converted into cDNA, using a high-capacity cDNA RT kit. Analysis of the results was performed with the 7300 RT-PCR System RQ Software version 1.4 (Thermo Fisher Scientific, Waltham, MA, USA). Efficiency of the control and treatment samples were checked using the slope of the graph of ΔCT values versus log of the total RNA sample. If the calculated slope was less than 0.1, then comparative CT method was used to compare the gene expression between control and treatment cells. These were normalized according to a housekeeping gene, β-actin, serving as an internal control (Table 1 ).
4
Coxsackie B Virus Capsid Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For sequencing, viral RNA extracted as indicated above was reverse transcribed with the high-fidelity OneScript Plus Reverse Transcriptase (Applied Biological Materials) using 8 μL of RNA and the primer CVB3_RT_3450 (GTGCTGTGGTCGTGCTCACTAA). To ensure sufficient diversity was present in the cDNA, the number of capsid copies in the cDNA was quantified via qPCR using PowerUp SYBR Green Master Mix (ThermoFisher Scientific) in a 10 μL total reaction, using 1 μL of the template and the primers CVB3_qPCR_F (CCCTGAATGCGGCTAATCC) and CVB3_qPCR_R (AAACACGGACACCCAAAGTAGTC). A standard curve was generated using the original reverse genetic plasmid encoding the CVB3 genome. The full capsid region was then amplified from the cDNA using KOD polymerase Mastermix (Novagen) and the primers CVB3_P1_seq_F (CCCTTTGTTGGGTTTATACCACTTAG) and CVB3_P1_seq_R (CCTGTAGTTCCCCACATACACTG). Duplex sequencing libraries were prepared as previously described22 (link) and sequenced on an Illumina Novaseq 6000 sequencer. The resulting files were analyzed as previously described22 (link) to obtain the counts of each codon at each position (codon tables, available on GitHub23 , section 1). As before, all single mutations in codons were omitted from the analysis to increase the signal-to-noise ratio22 (link).
5
Identification of Circular RNAs by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR to identify end-to-end STS product as circRNA was carried out using specific forward and reverse primers (STS F and R) (Table S3 ). For reverse transcription, OneScript plus reverse transcriptase (Applied Biological Materials, Richmond, Canada) was used following the manufacturer’s protocol in 20-μL reactions with 100 ng RNAs. Resulting cDNAs were subjected to 35 cycles of standard PCR using an AccuPower Taq PCR premix (Bioneer).
The amplified specific band was extracted from agarose gel using a LaboPass gel extraction kit (Cosmogenetech). Sequencing was performed by Cosmogenetech after TA cloning using a TOPcloner TA-Blunt kit (Enzynomics).
The amplified specific band was extracted from agarose gel using a LaboPass gel extraction kit (Cosmogenetech). Sequencing was performed by Cosmogenetech after TA cloning using a TOPcloner TA-Blunt kit (Enzynomics).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!