Real time pcr system

Manufactured by Thermo Fisher Scientific

Sourced in United States, China, Japan, United Kingdom, Germany, Singapore, Canada, Finland, Switzerland, Australia, France

The Real-Time PCR System is a laboratory instrument used for the amplification and detection of specific DNA sequences in real-time. It is designed to precisely quantify the amount of a target DNA or RNA molecule in a sample.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Real-Time System (23 citations) Applied Biosystems StepOne Plus Real-Time PCR Systems (5 citations) StepOnePlus Real-Time PCR Systems thermocycler (4 citations) StepOnePlus Real-Time PCR Systems machine (4 citations) Applied Biosystems 7,500 Fast Real-Time PCR systems (4 citations) 7500 and 7500 Fast Real-Time PCR Systems (4 citations) QuantStudio 5 real-time RT-PCR systems (3 citations) QuantStudio7 Flex Real-Time PCR systems (3 citations) QuantumStudio3TM Real-Time PCR Systems (3 citations) Step One andStep One Plus Real time PCR systems (3 citations)

666 protocols using real time pcr system

RNA Isolation and qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

5∗10⁵ cells were washed resuspend in 400 μL TRIreagent. RNA isolation was then performed according to the isolation protocol from TRIreagent supplier (SIGMA). In brief, 0.1 mL of 1-bromo-3-chloropropane per mL of TRI Reagent was added, samples were mixed by vigorous shaking, incubated for 15 min at room temperature and then centrifuged at 12’000 g for 15 min at 4°C for phase separation. The aqueous phase was then mixed with 0.5 mL of isopropanol per mL of TRI Reagent used, again centrifuged for 10 min for RNA precipitation. RNA was then washed with 70% Ethanol and finally resuspend in RNAse-free water. RNA concentration and purity was determined with a Nanodrop2000 Spectrophotometer (ThermoScientific).
For Rcan3 qPCR, reverse transcription was performed using the SIGMA MMLV kit on 1 μg RNA according to the manufacturer’s instructions. qPCR was run with TaqMan FAST Universal PCR master mix on an Applied Biosystems® Real-Time PCR System. 18S was used as a reference gene.
For miRNA17 qPCR, reverse transcription was performed using the TaqMan MicroRNA Reverse Transcription Kit (ABI) and a miRNA-specific reverse stem-loop primer according to the manufacturer’s instructions (Moltzahn et al., 2011 (link)). qPCR was run with TaqMan FAST Universal PCR master mix on an Applied Biosystems® Real-Time PCR System. SNO234 was used as a reference gene.

Dölz M., Hasiuk M., Gagnon J.D., Kornete M., Marone R., Bantug G., Kageyama R., Hess C., Ansel K.M., Seyres D., Roux J, & Jeker L.T. (2022). Forced expression of the non-coding RNA miR-17∼92 restores activation and function in CD28-deficient CD4+ T cells. iScience, 25(11), 105372.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Inflammatory Cytokines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from liver tissues using TRIzol reagent (Thermo Fisher, #15596026, Waltham). Equal amounts of RNA (5000 ng) were reverse transcribed into cDNA using an All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (TransGen Biotech, #AE341, Beijing) according to the manufacturer’s protocols on a Real-Time PCR System (Applied Biosystems, #9902, Waltham). Quantitative real-time PCR (QPCR) was performed using Top Green qPCR SuperMix (TransGen Biotech, #AQ132, Beijing) on a Real-Time PCR System (Applied Biosystems, #Q6, Waltham). Details of the primers can be found in Table 2. The relative quantification of real-time RT–PCR products was performed using the 2^–ΔΔCT method.Table 2

Primers Used for qRT–PCR Analysis

Gene Name	Forward Primer Sequence (5’-3’)	Reverse Primer Sequence (5’-3’)
IL-1β	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG
IL-6	TAGTCCTTCCTACCCCAATTTCC	TTGGTCCTTAGCCACTCCTTC
TNF-α	GGGGATACATCCATCAGGGGT	GCTCGGACAGTCACTCACC
IL-10	CTTACTGACTGGCATGAGGATCA	GCAGCTCTAGGAGCATGTGG
GAPDH	CAGTATGACTCCACTCACGGCAA	CTCGCTCCTGGAAGATGGTGAT

Xu R., Qiu S., Zhang J., Liu X., Zhang L., Xing H., You M., Wang M., Lu Y., Zhang P, & Zhu J. (2022). Silibinin Schiff Base Derivatives Counteract CCl4-Induced Acute Liver Injury by Enhancing Anti-Inflammatory and Antiapoptotic Bioactivities. Drug Design, Development and Therapy, 16, 1441-1456.

+ Open protocol

+ Expand

Quantification of ITGB1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the cells using a TRIzol™ Plus Kit (Takara, Osaka, Japan) according to the manufacturer's instructions. Synthesized cDNA was prepared with a real-time PCR System (Life Technologies, Carlsbad, CA, USA) for qRT-PCR using an Applied Biosystems 7500 real-time PCR System with SYBR™ Green Master Mix (Takara, Osaka, Japan). The relative expression of ITGB1 was determined with the 2^-△△Ct method after normalization to the expression of GAPDH. The primers for ITGB1 were: forward, 5′-AAATGTAACCAACCGTAGC-3′ and reverse, 5′-GACAGGTCCATAAGGTAGTAGA-3′.

Li Y., Sun C., Tan Y., Zhang H., Li Y, & Zou H. (2021). ITGB1 enhances the Radioresistance of human Non-small Cell Lung Cancer Cells by modulating the DNA damage response and YAP1-induced Epithelial-mesenchymal Transition. International Journal of Biological Sciences, 17(2), 635-650.

+ Open protocol

+ Expand

Quantifying Kidney Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation and real-time PCR were performed according to protocols previously described in detail 16 (link). In brief, total mRNA from kidney tissue was extracted using the TRIzol reagent (RNA STAT 60 Tel-Test; Ambion, Austin, TX, USA). cDNA was used in the specific assays by Real-Time PCR system (Life Technologies Corporation, Carlsbad, CA, USA) on demand target mixes (Applied Biosystems, Foster City, CA, USA). The expression levels of mRNA encoding for TGF-β, FN, collagen I, and collagen IV in the kidney tissue were determined and normalized to the level of GAPDH (Applied Biosystems). The cycle times (Ct) were then compared to determine the fold differences between samples.

Zheng Z., Ma T., Lian X., Gao J., Wang W., Weng W., Lu X., Sun W., Cheng Y., Fu Y., Rane M.J., Gozal E, & Cai L. (2019). Clopidogrel Reduces Fibronectin Accumulation and Improves Diabetes-Induced Renal Fibrosis. International Journal of Biological Sciences, 15(1), 239-252.

+ Open protocol

+ Expand

Quantification of WTAP mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from snap-frozen ovary tissues and cultured cell lines was isolated using TRIzol reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol, and then underwent reverse transcription to generate complementary DNA using a PrimeScript™ RT reagent kit (Takara Biotechnology Co. Ltd., Dalian, China). Quantitative real-time PCR was performed using SYBR Green mix (Takara Biotechnology Co. Ltd., Dalian, China) in a Real-Time PCR system (Life Technologies, Carlsbad, CA, USA). Target gene expression was normalized to GAPDH expression, and the relative mRNA abundance was calculated utilizing the ΔΔCt method. Real-time PCR was performed using the following specific primers: WTAP (forward) 5ʹ-TTGTAATGCGACTAGCAACCAA-3ʹ and (reverse) 5ʹ- GCTGGGTCTACCATTGTTGATCT-3ʹ.

Yu H.L., Ma X.D., Tong J.F., Li J.Q., Guan X.J, & Yang J.H. (2019). WTAP is a prognostic marker of high-grade serous ovarian cancer and regulates the progression of ovarian cancer cells. OncoTargets and therapy, 12, 6191-6201.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Glucocorticoid Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was reverse transcribed with the high capacity cDNA reverse transcription kit, and cDNA was quantitated by PCR using a 7900HT real-time PCR system and specific Taqman assays for GR-α, GR-β, FKBP51, TTP, DUSP-1 (formerly MKP1), GILZ, and IRF8, normalized with an endogenous control (β-actin), using the 2^−ΔΔCt method, all according to the manufacturer's instructions (all from Life Technologies).

Escoll P., Ranz I., Muñoz-Antón N., van-den-Rym A., Alvarez-Mon M., Martínez-Alonso C., Sanz E, & de-la-Hera A. (2015). Sustained Interleukin-1β Exposure Modulates Multiple Steps in Glucocorticoid Receptor Signaling, Promoting Split-Resistance to the Transactivation of Prominent Anti-Inflammatory Genes by Glucocorticoids. Mediators of Inflammation, 2015, 347965.

+ Open protocol

+ Expand

Quantifying microglial gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from the hemi-brain (or from co-cultured Cx3cr1^−/− microglia) was extracted using the Trizol Reagent as described by the manufacturer (Life Technologies). Total RNA (100 ng/μL) was converted to cDNA using the High Capacity cDNA Reverse Transcription kit (Life Technologies, 4368813) and amplified using specific TaqMan probes (Life Technologies, 4331182, see Table 1) and GAPDH was used as a house-keeping gene for normalization, on the StepOnePlus® Life Technologies Real-Time PCR System.

Maphis N., Xu G., Kokiko-Cochran O.N., Cardona A.E., Ransohoff R.M., Lamb B.T, & Bhaskar K. (2015). Loss of tau rescues inflammation-mediated neurodegeneration. Frontiers in Neuroscience, 9, 196.

+ Open protocol

+ Expand

Liver RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using previously published methods [20 (link)]. Briefly, frozen liver tissue was ground in liquid nitrogen and the Direct-zol™ RNA MiniPrep kit (Zymo Research) was used for RNA isolation. RT-PCR was performed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) and incubated in a 2720 Thermal Cycler (Applied Biosystems). A serially diluted standard curve was created, and qPCR was carried out using Power SYBR^® Green Master Mix (Life Technologies) run in a StepOnePlus™ Real-Time PCR System. All primers were designed using Vector NTI (Life Technologies) and manufactured by Integrated DNA Technologies. Information regarding primers for gene expression is detailed in Table 2.

Moody L., Shao J., Chen H, & Pan Y.X. (2019). Maternal Low-Fat Diet Programs the Hepatic Epigenome despite Exposure to an Obesogenic Postnatal Diet. Nutrients, 11(9), 2075.

+ Open protocol

+ Expand

Total RNA Isolation and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

At 24 h post-transfection, total RNA was isolated using TRIzol (Life Technologies) per the manufacturer's instructions. Briefly, growth medium was removed from cells, and cells were washed once with PBS. TRIzol was added directly to the plate, and cells scraped and harvested. The aqueous phase of a phenol-chloroform extraction was mixed with isopropanol to precipitate the total RNA. The RNA was further treated with DNase I (Life Technologies) to avoid false-positives caused by DNA contamination and then re-precipitated. For RT-qPCR, 1–2ug total RNA was used to synthesize cDNA using StepOne Real-Time PCR System at 48°C for 30 mins, followed by qPCR using Express One–Step Superscript RT-qPCR Kit (Life Technologies). Primer probe sets include 2 primers (a forward and reverse) as well as an internal probe and were selected to be either upstream or downstream of the amplicon site (Supplementary Figure S1). For all RT-qPCR reactions, we report means and standards deviations from 3 independent experiments with triplicate samples in each experiment and the data are normalized to Ribogreen (Life Technologies). The primer probe sets used in RT-qPCR are listed in Supplementary Figure S1 and Supplementary Materials.

Lima W.F., De Hoyos C.L., Liang X.H, & Crooke S.T. (2016). RNA cleavage products generated by antisense oligonucleotides and siRNAs are processed by the RNA surveillance machinery. Nucleic Acids Research, 44(7), 3351-3363.

+ Open protocol

+ Expand

Real-Time Quantification of Astrocyte Immune Responses to Trypanosoma cruzi

Check if the same lab product or an alternative is used in the 5 most similar protocols

For real-time quantitative RT-PCR (RT-qPCR), 10⁶ astrocytes were cultivated in a 6-well plate (NUNC, Roskilde, Denmark), infected with T. cruzi (MOI 1:1), and cultivated as described above. After 4 h of culture, astrocytes were washed with warm PBS to remove debris, harvested by gentle scraping with a rubber policeman, and frozen in RNAlater (# AM7021, Life Technologies, Carlsbad, CA, USA). Total RNA was extracted using TRI-Reagent (Sigma-Aldrich, St. Louis, MO, USA), after the complete removal of RNAlater. All reverse transcriptase reactions were performed using the SuperScript VILO cDNA Synthesis Kit (Life Technologies, Carlsbad, CA, USA), and real-time RT-qPCR was performed on a Real-Time PCR System (Life Technologies, Carlsbad, CA, USA) using TaqMan gene expression kits (Life Technologies, Carlsbad, CA, USA) for Tnf (# Mm00443258_m1) and Tnfr1 (#Mm00441883_g1), as well as the endogenous housekeeping control genes glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (# Mm99999915_g1) and β actin (# Mm00607939_s1), purchased from Life Technologies (Carlsbad, CA, USA). The reactions were performed and analyzed as described previously [28 (link)].

Silva A.A., Silva R.R., Gibaldi D., Mariante R.M., dos Santos J.B., Pereira I.R., Moreira O.C, & Lannes-Vieira J. (2017). Priming astrocytes with TNF enhances their susceptibility to Trypanosoma cruzi infection and creates a self-sustaining inflammatory milieu. Journal of Neuroinflammation, 14, 182.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!