The variant identified by the targeted sequencing was confirmed by Sanger sequencing. The region of genome including the mutations was amplified by PCR and sequenced both strands. Exon-specific Sanger sequencing was performed using 5′-GAGCTTGGGCACCACCTG-3′ and 5′-TCCGCTCCCCAAAACTCC-3′ primers on Applied Biosystems 3500 Genetic Analyzer. The sequences were evaluated by two different sequencing programs; i.e., CLC Genomics Workbench 3 sequencing program (Qiagen) and Chromas lite Software (Technelysium, South Brisbane QLD, Australia).
Chromas lite software
Manufactured by Technelysium
Sourced in Australia
Chromas Lite is a software application for DNA sequence analysis. It provides a graphical representation of DNA sequencing data, allowing users to view and analyze the raw data output from sequencing instruments.
Automatically generated - may contain errors
Lab products found in correlation
High pure pcr product purification kit, by Roche (3 mentions)
Abi prism 3130xl genetic analyzer, by Thermo Fisher Scientific (3 mentions)
Seqman, by DNASTAR (2 mentions)
Abi prism bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (2 mentions)
Ab3130xl, by Thermo Fisher Scientific (2 mentions)
Mutation surveyor software, by SoftGenetics (2 mentions)
3500 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Clc genomics workbench 3 sequencing program, by Qiagen (1 mentions)
Abi 3730xl, by Thermo Fisher Scientific (1 mentions)
Nanodrop instrument, by Thermo Fisher Scientific (1 mentions)
Dna mini kit, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Dna free dna removal kit, by Thermo Fisher Scientific (1 mentions)
Retroscript kit, by Thermo Fisher Scientific (1 mentions)
Dntp mix, by Thermo Fisher Scientific (1 mentions)
Platinum taq dna polymerase high fidelity, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Abi prism dna sequencer, by Thermo Fisher Scientific (1 mentions)
Sanger sequencer, by Thermo Fisher Scientific (1 mentions)
Sigmaspin post reaction clean up columns, by Merck Group (1 mentions)
19 protocols using chromas lite software
1
Sanger Sequencing for Variant Confirmation
2
Genomic DNA Extraction and KISS1 Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from peripheral blood of the patient by salting out method. After proving the quality and quantity of extracted DNA samples by nano-drop instrument (thermo scientific), the samples were stored at −20°C. PCR was performed using 3 set of primers to amplify all coding exons and flanking intron region of Kiss1 gene. Primer sequences to amplify exon 1–3 were as follows, respectively:
EXON 1 F: GGGCTTTATAAAAGGGATGTG
EXON 1 R: CTTAGAACGGATTCCCTG
EXON 2 F: CAGATCCTGTGCCTGACCT
EXON 2 R: TTGCAACAACCCACTTGCT
EXON 3 F: GTGTTGCAAAGCCATCTTTC
EXON 3 R: TCTTTTATTGCCTCGGGTTG
In this study, all PCR reactions were performed in a 25 μl reaction containing 1.5 mM MgCl2, 200 mM of each dNTPs, I U of Taq DNA polymerase (Feldan, Germany) 150 ng DNA and 25 pmol of each primers.
The amplifications were conducted over 35 cycles, after initial denaturation at 94°C for 5 min, each cycle was performed using the following conditions; denaturation at 94°C for 1 min, annealing at 58°C (for exon 1 and 2) or 49°C (for exon 3) for 45 s, and extension at 72°C for 1 min. Additional extension at 72°C for 10 min after the last amplification cycle was performed.
PCR products were separated on 2% agarose gel electrophoresis and sequenced with ABI 3730xl (Life Technologies, USA) automated sequencer and analyzed with Chromas Lite software (Technelysium Pty Ltd, Australia; Windows).
EXON 1 F: GGGCTTTATAAAAGGGATGTG
EXON 1 R: CTTAGAACGGATTCCCTG
EXON 2 F: CAGATCCTGTGCCTGACCT
EXON 2 R: TTGCAACAACCCACTTGCT
EXON 3 F: GTGTTGCAAAGCCATCTTTC
EXON 3 R: TCTTTTATTGCCTCGGGTTG
In this study, all PCR reactions were performed in a 25 μl reaction containing 1.5 mM MgCl2, 200 mM of each dNTPs, I U of Taq DNA polymerase (Feldan, Germany) 150 ng DNA and 25 pmol of each primers.
The amplifications were conducted over 35 cycles, after initial denaturation at 94°C for 5 min, each cycle was performed using the following conditions; denaturation at 94°C for 1 min, annealing at 58°C (for exon 1 and 2) or 49°C (for exon 3) for 45 s, and extension at 72°C for 1 min. Additional extension at 72°C for 10 min after the last amplification cycle was performed.
PCR products were separated on 2% agarose gel electrophoresis and sequenced with ABI 3730xl (Life Technologies, USA) automated sequencer and analyzed with Chromas Lite software (Technelysium Pty Ltd, Australia; Windows).
3
Molecular Identification of Microbes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Molecular identification was done by sequencing 16S rRNA gene amplified by polymerase chain reaction (PCR) using 16S rRNA gene primers Fwd27 and Rev1492 [21 ]. PCR amplicons were purified using a High Pure PCR Product Purification Kit (Roche, Basel, Switzerland) following the manufacturer’s protocol. The PCR amplicons were sequenced on an ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems, Waltham, MA, USA). The sequences so obtained were edited by Chromas Lite software (Technelysium Pty Ltd., Brisbane, Australia) and assembled using SeqMan (DNASTAR, Inc., Madison, WI, USA). Searching for 16S rRNA gene sequence similarity was performed at the GenBank data library using the BLASTN program (NCBI, Bethesda, MD, USA).
4
Multilocus Sequence Typing of Streptococcus agalactiae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosomal DNA was extracted from overnight cultures of isolates cultivated at 35 °C on 5% Müeller-Hinton agar using a DNA Mini Kit (QIAGEN, Germany) according to the manufacturer’s instructions. Seven housekeeping genes (adhP, pheS, atr, glnA, sdhA, glcK, and tkt) were amplified with PCR using oligonucleotide primers [11 (link)]. The amplification products were sequenced by Shenzhen Huada Gene Technology Co. Ltd. The amplification and sequencing primers were submitted to the GBS MLST database (http://pubmlst.org/sagalactiae/info/primers.shtml ) for the purpose of designation. We used the Chromas Lite software (version 2.6.5, Technelysium Pty. Ltd., Tewantin, Queensland, Australia) for correction and the MLST database (http://pubmlst.org/sagalactiae ) to assign alleles at the seven loci. We defined each isolate by the sequence type (ST) [13 (link)].
5
Targeted Mutation Screening of Tumor Suppressors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was purified from cell pellets using the RNeasy® Mini Kit (QIAGEN, 74104) according the manufacturer’s protocol. To eliminate possible genomic DNA contaminations the RNA samples were treated with DNA-freeTM DNA Removal Kit (Ambion®, Life Technology, AM1906). Complementary DNA (cDNA) was synthesized from RNA templates using the RETROscript® Kit (Ambion®, Life technology, AM1710). To amplify Tp53 and Kras sequences form cDNA and genomic DNA for sequencing as templates gene specific primers were designed (see Supplementary Table 6) and purchased from Eurofins, Martinsried, Germany. PCRs were carried out using Platinum Taq High Fidelity DNA polymerase (Invitrogen, 11304–029) and 10 mM dNTP Mix (PCR Grade, Invitrogen, Life Technologies, 18427–088). Trp53 and Kras PCR products were sent for Sanger sequencing to external companies (GATC Biotech, Constance, Germany and LGC Genomics, Berlin, Germany). Received sequences were screened for mutations by alignment with corresponding wild-type sequences (Serial Cloner, SerialBasics and BLAST, NCBI) and analysis of sequencing histograms employing Chromas Lite software (Technelysium).
6
Molecular Pathogenicity Determination
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro (molecular) pathogenicity determination was conducted based on the sequencing of the F gene of all 14 viruses and determination of their cleavage sites of the deduced amino acid sequences. A one-step reverse transcription polymerase chain reaction (RT-PCR) was run in 25µL volume according to and using primers of Kim et al.13 (link) The PCR products were separated by gel electrophoresis on 1.5% agarose gel (biotechnology grade or electrophoresis grade). The PCR products were excised and eluted from the agarose gel using QIAquick® Gel Extraction Kit following the manufacturer's recommendations. The amount of PCR product elutes from the agarose gel were then estimated by Nanodrop spectrophotometry (PeQLab Biotechnology, GmbH, Germany) and subsequently used for sequencing.
The amplicon was sequenced in both directions using the amplification primers using the Big DyeTM Terminator Cycle Sequencing Kit and an ABI Prism® DNA Sequencer (3130 Genetic Analyzer, Applied Biosystems). The gene sequencing reaction product was cleaned by Sigma Spin Post-Reaction Clean-Up Columns according to the manufacturer’s instructions (Sigma). The nucleotide sequences generated using Sanger Sequencer (sequence analyser) (Applied Biosystems) were edited by Chromas Lite software (Technelysium Pty Ltd, Australia) and used for molecular characterization.
The amplicon was sequenced in both directions using the amplification primers using the Big DyeTM Terminator Cycle Sequencing Kit and an ABI Prism® DNA Sequencer (3130 Genetic Analyzer, Applied Biosystems). The gene sequencing reaction product was cleaned by Sigma Spin Post-Reaction Clean-Up Columns according to the manufacturer’s instructions (Sigma). The nucleotide sequences generated using Sanger Sequencer (sequence analyser) (Applied Biosystems) were edited by Chromas Lite software (Technelysium Pty Ltd, Australia) and used for molecular characterization.
7
Quantifying Insecticide Resistance Alleles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Triplicates for each sample containing sequencing primers for either the M815I mutation or the T917I and L920F mutations (Kwon et al. 2008 (link)) were mixed with 10 µl of purified PCR product, loaded into a 96-well plate, and sent to GeneWiz (South Plainfield, NJ). Sequence chromatograms were analyzed using Chromas lite software (Technelysium Pty Ltd., Tewantin, Australia) to determine the nucleotide signal intensity at the respective mutation sites, and the nucleotide signal ratios (NSRs) were calculated as ([Resistant Nucleotide Signal] / [Resistant Nucleotide Signal + Susceptible Nucleotide Signal]). The NSR was entered into the standard curve equation to predict the kdr-type resistance allele frequencies (RAFs) at all three mutations.
8
Validating Genetic Variants in Hepatoblastoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prioritized variants from seven candidate genes (from our study and the literature; CTNNB1, TERT promoter, CAPRIN2, CX3CL1, CEP164, AXIN1, and DEPDC5) were validated by Sanger sequencing (sequences upon request) in the HB exome cohort of 10 tumors and investigated in 24 additional samples (12 HBs of the validation group and additional 12 HBs from formalin-fixed paraffin-embedded samples that were contained in a tissue microarray previously made in the institution; the clinical information about the cases included in the tissue microarray is available in Supplementary Table 2 ). Fourteen HB cases from the Texas Children's Hospital were screened for the CX3CL1 variant. Polymerase chain reactions (PCR) were performed using standard conditions [95°C, 5 min (44°C, 30 s; 72°C, 30 s; 72°C, 45 s) × 30 cycle; 72°C, 10 min], and amplicons were sequenced in both directions using an ABI 3730 DNA sequencer (Applied Biosystems, Foster City, CA); sequences were aligned with the respective gene reference sequence using Chromas Lite software (Technelysium, South Brisbane, QLD).
9
Automated DNA Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PCR products were sequenced using the Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher) and resolved on an automated ABI-3130xl DNA genetic analyzer (Thermo Fisher). The results were analyzed by means of Chromas Lite software (Technelysium Pty Ltd, South Brisbane, Australia).
10
Bacterial 16S rRNA gene amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The 16S rRNA genes were amplified using a set of universal primers, 8F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-ACGGCTACCTTGTTACGACTT-3′) (Weisburg et al., 1991 (link)). Each 50 μl of PCR reactions contained 25 μl of 2 × EasyTaq PCR Supermix (TransGen Biotech, China), 10 μM of each primer and 5 μl of genomic DNA as a template. Thermal cycling was performed in a G-storm GS1 thermal cycler (GRI, Ltd., Essex, United Kingdom) with the following parameters: initial denaturation step of 95°C for 1 min, followed by 30 cycles of 95°C for 15 s, 57°C for 15 s, and 72°C for 10 s. A final extension step consisting of 72°C for 5 min was included. Amplification products were checked by 1% (w/v) agarose gel electrophoresis. PCR amplicons were then sequenced (Apical Scientific Sdn. Bhd., Seri Kembangan, Malaysia). The sequences were analyzed and edited with Chromas Lite software (version 2.6.5; Technelysium Pty. Ltd., South Brisbane, QLD, Australia) and compared against the sequences in the National Center of Biotechnology Information (NCBI) database by using the BLASTn program1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!