Mission shrna library

Bacterial stocks containing lentiviral shRNA for a target gene were purchased from MilliporeSigma (MISSION shRNA library, Supplementary Data 7). Lentiviral vector carrying shRNA for KD or non-target sequence (MilliporeSigma, SHC202) was transfected to HEK293T cells at 70% confluency using GenJet™ In Vitro DNA Transfection Reagent (SignaGen Laboratories, SL100488), according to the manufacturer’s instructions. After 18 h, HEK293T medium was replaced with TSC medium. Viral supernatants were harvested 24 h and 48 h following medium replacement. To KD a target gene, TSC were infected in viral supernatant containing polybrene (Santa Cruz Biotechnology, sc-134220) at a final concentration of 10 μg/mL. After 18 h, the infected cells were induced to differentiate into EVT using EVT differentiation media supplemented with puromycin at a final concentration of 1 μg/mL. For the time-course KD of TFAP2C, the viral media was applied to TSC for early knockdown (Early-KD), and to differentiating cells at day 3 (Mid-KD) and day 5 (Late-KD). The differentiation media supplemented with puromycin was used according to the specific differentiation time, replacing the media after 18 h of infection.

The following plasmids were purchased from Addgene (Watertown, MA, USA): a lentiviral negative control vector containing scrambled shRNA (#1864, sh-unr) [31 (link)]; Rac1 generation fluorescence resonance energy transfer (FRET) biosensor for lentivirus production (#66111, pLenti-Rac1-2G) [32 (link)]; FRET-based biosensor reporting on Cdc42 activation (#68813, pLenti-Cdc42-2G) [33 (link)]; RhoA second-generation FRET biosensor for lentivirus production (#40179, pLenti-RhoA-2G) [34 (link)].
shRNA-mediated knockdown of CD93 was performed as previously outlined [4 (link)] by using a pLKO.1 retroviral vector from the Mission shRNA Library (Merck KGaA, Darmstadt, Germany), which expresses a shRNA (clone TRCN0000029085) specific for the silencing of the human protein. Recombinant lentiviral particles were produced and used for infection experiments as earlier described [35 (link)].

All short hairpin RNAs (shRNA) were purchased from Merck (Darmstadt, Germany) and were part of their MISSION^® shRNA library. Lentiviral particles were generated to transduce target cells as described before [16 (link)]. The expression of Nrf2 and Keap1 in C28/I2 chondrocytes was inhibited by two different shRNA constructs each and was used with the commercial non-target control (NTC) shRNA construct, 5′-CCGGCGCGATAGCGCTAATAATTTCTCGAGAAATTATTAGCGCTATCGCGCTTTTT-3′ (Cat. #SHC016, Merck, Darmstadt, Germany). The shRNA sequences were as follows: Nrf2 shRNA-1 (TRC clone ID: TRCN0000007558), 5′-CCGGCCGGCATTTCACTAAACACAACTCGAGTTGTGTTTAGTGAAATGCCGGTTTTT-3′; Nrf2 shRNA-2 (TRC clone ID: TRCN0000007555), 5′-CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTT-3′; Keap1 shRNA-1 (TRC clone ID: TRCN0000154657), 5′-CCGGGCGAATGATCACAGCAATGAACTCGAGTTCATTGCTGTGATCATTCGCTTTTTTG-3′; Keap1 shRNA-2 (TRC clone ID: TRCN0000156676), 5′-CCGGGTGGCGAATGATCACAGCAATCTCGAGATTGCTGTGATCATTCGCCACTTTTTTG-3′.

pcDNA-Myc-Rheb was kindly provided by Liz Henske (Division of Pulmonary and Critical Care Medicine, Department of Medicine, Brigham and Women’s Hospital, Boston, U.S.A). pLKO.1-shRheb was generated in the Biomics Center of the Erasmus Medical Center (Rotterdam, The Netherlands) using the MISSION^tm shRNA library (Sigma-Aldrich). The shRheb targeting sequence is CCTCAGACATACTCCATAGAT. pGEX4T-PAK-Crib vector contains the RAC-binding domain of PAK2 and was cloned using BamHI and EcoRI restriction sites.

The plasmids pcDNA3-TRPC6 and pcDNA3-EV were described previously^{67 (link)}. Cells were transfected with the plasmids using the Lipofectamine® 2000 Transfection Reagent (Invitrogen, USA) according to the manufacturer’s protocol. The Opti-MEM (Gibco, USA) medium was replaced with DMEM/F12 and 10% FBS after 6–8 h incubation, and the cells were used for the experiments after 24 h. The shRNA against TRPC6 was from the MISSION^(TM) shRNA Library (Sigma-Aldrich). The sequence was as follows: TRPC6, CCGGCCAGAGCATCATTGACGCAAACTCGAGTTTGCGTCAATGATGCTCTGGTTTTTG. ShMOCK refers to an empty vector. Lentivirus production and concentration were done as described^{68 (link)}. In brief, HEK293T cells were co-transfected with lentiviral vector plasmid (pLKO.1-shTRPC6) and packaging plasmids psPAX2 and pMD2.G, using the PolyJet Transfection Reagent (SignaGen Laboratories, USA). The medium was changed on the next day, and cells were cultured for another 24 h. Conditioned medium was then collected, filtered through a 0.45-μm filter, and concentrated by ultrafiltration using Amicon Ultra filtration units (Millipore, USA). HK-2 cells at 60% confluence were infected with shTRPC6 or shMOCK lentivirus. The medium was replaced 24 h after infection, and then the cells were used for the experiments.