Snapgene

Serial backcrossing to a wild type (yw) background was performed for three consecutive generations. The single rab mutants as well as the respective balancer chromosomes, used to generate the final stocks, were backcrossed to the same genetic background. All mutant alleles, except rab3 and rab32, could be traced by their red fluorescent marker. Where direct tracing was not possible, backcrossing was performed ‘blindly’ and after three generations roughly 100 separate single (fe-)male stocks were generated and subsequently sequenced to identify the backcrossed rab3 and rab32 mutants.
The genomic DNA was amplified using the Phusion High-Fidelity PCR Kit (Thermo Fisher Scientific) with the following primers for rab3 (Fwd: 5’-ACACTGAGGCGAGCTTACGC and Rev: 5’- CTACTACCGAGGAGCGATGGG) and rab32 (Fwd: 5’-GTAGACACGGGTCATGTTGCC and Rev: 5’-accagcaaatctcagtgcgg). The amplified DNA was extracted from agarose gel, cleaned using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel) and send for sequencing to Microsynth Seqlab GmbH (Göttingen, Germany). Sequencing results were visualized using SnapGene (GSL Biotech LLC). All primers were designed with SnapGene (GSL Biotech LLC).

All plasmids used in this study were constructed using standard cloning methods such as restriction enzyme‐based cloning (Thermo Fisher Scientific, Waltham, MA, USA) or HiFi DNA assembly (New England Biolabs), following the instructions from the manufacturer. Standard molecular biology techniques were carried out for DNA manipulations such as DNA isolation, ligation, electrophoresis, cloning, competent cell preparation and transformation (Green & Sambrook, 2012 ). The oligonucleotides used in this study are listed in Table S2 and ordered from Integrated DNA Technologies (IDT, San Diego, CA, USA). PCR conditions were optimized for each primer pair, and gene fragments were amplified using Q5 High‐Fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA). Colony PCR was performed to confirm cloning success using Taq polymerase (New England Biolabs, Ipswich MA, USA). Subsequently, the selected clones were sequence‐verified using the Sanger Sequencing service (Genewiz, CA, USA). Commercial kits from Qiagen (Hilden, Germany) were used to isolate recombinant plasmids from E. coli and to separate PCR products (or concentrate DNA) from agarose gels (1% w/v). Primer designing (SnapGene, GSL Biotech; available at SnapGene.com">SnapGene.com), vector map generation (SnapGene), graph preparation (GraphPad Prism) and gene analysis (NCBI Blast) were performed using basic bioinformatics tools.

Sequence analysis was carried out using the SnapGene (GSL Biotech; available at SnapGene.com">https://www.SnapGene.com) sequence analysis software package. The BLAST algorithm (http://www.ncbi.nlm.nih.gov/BLAST) was used to search the DNA and protein database for similarity. Multiple sequence analysis was done using JALVIEW (Waterhouse et al., 2009 (link)) with the Clustal (Thompson et al., 1994 (link)) algorithm.

Colistin-resistant Acinetobacter spp. isolates were subjected to NGS (Macrogen, Korea), and the genome sequences of these strains were obtained using the Illumina HiSeqXten platform (USA). The acquired antimicrobial resistant gene and plasmid replicon typing were identified in silico using ResFinder 3.2 and the PlasmidFinder 2.1 webserver (https://cge.cbs.dtu.dk, accessed June 24, 2020), respectively [11 (link), 12 (link)]. The genome was annotated using RAST (http://rast.theseed.org/) to analyze the genetic environment of mcr [13 (link)]. BLAST was used to align the genetic sequences flanking mcr (www.ncbi.nlm.nih.gov/BLASTih.gov/BL). The results were visualized using SnapGene (GSL Biotech; available at SnapGene.com). ISfinder was used to check the presence and type of the insertion sequence in a contig (database URL, http://www-is.biotoul.fr) [14 (link)].