We selected an RNAsimple Total RNA Kit (TIANGEN, Beijing, China) to extract total RNA from cervical cancer cell lines. The Servicebio®RT First Strand cDNA Synthesis Kit was used for qRT-PCR (Servicebio, Wuhan, China). Next, we performed real-time PCR using TB Green® Premix Ex TaqTM (Takara, Japan). The primers used were as follows: human INHBA -Forward: 5′-ATCATCACGTTTGCCGAGTCA-3′; human INHBA -Reverse: 5′-GAAGAGGCGGATGGTGACTTT-3′; human GAPDH-Forward: 5′-GGAGTCCACTGGCGTCTTCA-3′; human GAPDH-Reverse, 5′-GTCATGAGTCCTTCCACGATACC-3′.
Rt first strand cdna synthesis kit
Manufactured by Wuhan Servicebio Technology
Sourced in China, United States
The RT First Strand cDNA Synthesis Kit is a laboratory product designed for the reverse transcription of RNA into complementary DNA (cDNA). It contains the necessary reagents and enzymes required to perform this fundamental step in molecular biology workflows.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Sybr green qpcr master mix, by Wuhan Servicebio Technology (5 mentions)
Sybr green qpcr master mix high rox, by Wuhan Servicebio Technology (3 mentions)
Sybr green pcr mix, by Wuhan Servicebio Technology (2 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Qrt pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Wuhan Servicebio Technology (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Tb green premix ex taqtm, by Takara Bio (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
Mouse ins insulin elisa kit, by Elabscience (1 mentions)
Ne pertm nuclear and cytoplasmic extraction reagent, by Thermo Fisher Scientific (1 mentions)
Tg assay kit, by Elabscience (1 mentions)
Histone h3, by Wuhan Servicebio Technology (1 mentions)
Metformin, by Merck Group (1 mentions)
He staining kit, by Solarbio (1 mentions)
Oil red o staining kit, by Solarbio (1 mentions)
Abi 7500 fast system, by Thermo Fisher Scientific (1 mentions)
23 protocols using rt first strand cdna synthesis kit
1
Quantifying INHBA Expression in Cervical Cancer
2
Quantifying Gene Expression in Liver Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the livers and hepatocytes using TRIzol™ Reagent (#15596018; ThermoFisher Scientific) and reversely transcribed to cDNA by the RT First Strand cDNA Synthesis Kit (#G3330; Servicebio, Wuhan, China) according to the manufacturer's instructions. Next, quantitative real-time PCR was performed with SYBR Green Master Mix and normalized to the internal control using the 2-∆∆Ct method [36 (link)–39 (link)]. The thermocycling conditions were as follows: 95°C for 10, then 40 cycles of 95°C for 2 sec, 60°C for 20 sec, and 70°C for 10 sec. The primer sequences were listed as follows: collagen 1α1 (Col1α1), forward, 5′-AGGCTTCAGTGGTTTGGATG-3′ and reverse, 5′-CACCAACAGCACCATCGTTA-3′; Col3α1, forward, 5′-CCCAACCCAGAGATCCCATT-3′ and reverse, 5′-GAAGCACAGGAGCAGGTGTAGA-3′; connective tissue growth factor (CTGF), forward, 5′-TGTGTGATGAGCCCAAGGAC-3′ and reverse, 5′-AGTTGGCTCGCATCATAGTTG-3′; transforming growth factor-beta 1 (TGF-β1), forward, 5′-TGCGCTTGCAGAGATTAAAA-3′ and reverse, 5′-CGTCAAAAGACAGCCACTCA-3′; miR-137-3p, forward 5′-TTATTGCTTAAGAATACGCG-3′ and reverse, 5′-TCGTATCCAGTGCAGGGTC-3′; GAPDH, forward, 5′-CGTGCCGCCTGGAGAAACC-3′ and reverse, 5′-TGGAAGAGTGGGAGTTGCTGTTG-3′; and U6, forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′.
3
Metformin Modulates Lipid Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Metformin (Met, C4H11N5·HCl; purity ≥97%), was provided by Sigma-Aldrich (D150959; Shanghai, China), and dissolved in sterile saline. Isoflurane for inhalation was purchased from RWD Life Science Co, Ltd (R510-22-4; Shenzhen, China). A high-fat diet consisted of 20% carbohydrate, 20% protein, and 60% fat (total 25.07 kJ/g), which was purchased from Beijing Botai Hongda Biotechnology (HD004; Beijing, China). Mouse INS (Insulin) ELISA Kit and TG assay Kit were acquired from Elabscience (E-EL-M1382c, E-BC-K261; Wuhan, China). H&E Staining Kit and Oil-red O Staining Kit were provided by Solar bio Science &Technology (G1120, G1261; Beijing, China). NE-PERTM Nuclear and Cytoplasmic Extraction Reagents were acquired from Thermo Fisher Scientific (78833; Waltham, MA, United States). Primary antibody against TFEB, Atg7, p62/SQSTM1 were purchased from Abcam (ab220695, ab133528, EPR4844; Discovery Drive, Cambridge Biomedical Campus, Cambridge, United Kingdom), LC3B was purchased from Cell Signaling (#83506; Boston, MA, United States). The primary antibody against GAPDH and Histone-H3 were acquired from Servicebio (GB12002, GB11102; Wuhan, China). The ECL Plus Reagent Kit was purchased from Millipore (P90720; Bedford, MA, United States). RT First Strand cDNA Synthesis Kit and 2×SYBR Green qPCR Master Mix (High ROX) were provided by Servicebio (G3330, G3322; Wuhan, China).
4
Quantitative Analysis of Hepatic Bile Acid Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the liver tissue using TRIzol reagent (Invitrogen, Waltham, MA, United States). cDNA was synthesized using the RT First-Strand cDNA Synthesis Kit (Servicebio, Wuhan, China). the relative level of mRNA amplification was determined using SYBR Green qPCR Master Mix (High ROX) (Servicebio) in accordance with the manufacturer’s instructions. GAPDH Primer Assay was used as a house keeping. The following primers were used: Cyp7a1′5′-GGCATCTCAAGCAAACACC’T-3′ (forward) an’ 5′-GC TGTGCG GATATTCA AGG’T-3′ (reverse); Cyp27a1′5′-CTGCCCTTTTGGAAGCGA’A-3′ (forward) an’ 5′-TTGGATGTCGTGTCTACC’C-3′ (reverse); Cyp8b1′ 5′-TTCAAGTACAATCGG TTCCT’A-3′ (forward) and 5′-GGTCCACCAGTTCAAAGTCAAA-3′ (reverse); BA conjugational enzymes (BACS),5′-GGCTGCTCAATCACAAATAGG-3′(forward) and 5′-CAGAAATGGACTTGGACGG-3′ (reverse); GAPDH, 5′-CTGGAGAAACCTGCCAAGTATG-3′ (forward) and 5′-GGTGGAAGAATGGGAGTTGCT-3′ (reverse).
5
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the EZNA Total RNA Kit II (Omega, No. R6934-01) following the protocol recommended by the manufacturer. RT First Strand cDNA Synthesis Kit (Servicebio, No. LT203701) was used for reverse transcription of RNA; polymerase chain reaction was performed using the ABI 7,500 FAST System (Thermo, USA) with SYBR Green qPCR Master Mix (Servicebio, No. MPC2011004). The target genes were NR4A1(forward, 5′-TTGGAAAGGAAGATGCCGG-3′, reverse, 5′-TGTCTATCCAGTCACCAAAGCC-3′), CS (forward, 5′-TAAGCTGGACTGGTCCCACA-3′, reverse, 5′-TGGTTTGCTAGTCCATGCAGA-3′), GAPDH (forward, 5′-CTGGAGAAACCTGCCAAGTATG-3′, reverse, 5′-GGTGGAAGAATGGGAGTTGCT-3′). All primers were supplied by Servicebio Biology Science and Technology Co., Ltd. GAPDH was used as a housekeeping transcript for normalization, and relative real-time PCR results were calculated using the 2–ΔΔCT method.
6
Quantifying Atrial miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the atrial tissue or cell using TRIzol® reagent (Takara, Japan). Isolated RNA (2 μg) was converted into complementary DNA using an RT First Strand cDNA Synthesis Kit (Servicebio, China). The mRNA was reverse transcribed using Oligo (dT) primers. Since primers were designed by the stem-loop methods, each miRNA reverse transcription needs to add the corresponding reverse transcription primer for reverse transcription (Table 1 ). The cDNA templates were amplified by qRT-PCR system (Applied Biosystem, United States) using SYBR Green PCR Mix (Servicebio, China) with the corresponding primers (Table 1 ). The 2-ΔΔCt comparative quantification method was used to analyze the semilog amplification curves, and the expression of gene and miRNA were normalized to GAPDH and U6, respectively.
7
Quantifying Circ0005654 Expression in Thyroid Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using RNA extraction methods (produced by Servicebio), total RNA from thyroid cancer tissues was isolated and quality tested. According to the Servicebio® protocol, the total RNA was reverse transcribed with the help of an RT First Strand cDNA Synthesis kit into template cDNA. The Gentier 96E/96R fully automatic medical PCR analysis system (produced by Xi’an Tianlong Technology Co., Ltd.) was used for the PCR. The total reaction volume was 10 µL and the experiment was performed according to the qRT-PCR kit instructions. The reaction conditions were: 95°C pre-denaturation for 30 seconds; then 95°C denaturation for 15 seconds, 60°C annealing for 30 seconds, and 60°C extension for 30 seconds, for a total of 40 cycles. For relative quantification of Circ0005654 expression, we used Glyceraldehyde Triphosphate Dehydrogenase as the internal reference and the 2−∆∆ ct method to calculate the relative expression of the genes. The primer sequences are shown in Table 1 .
8
RNA Extraction and Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA Extraction Solution (Servicebio, G3013, Wuhan, China) was utilized to extract total RNA from the femoral artery. The RNA Extraction Kit was (R0024, Beyotime, Shanghai, China) utilized to extract total RNA from HUVECs. RT First Strand cDNA Synthesis Kit (Servicebio, G3330, Wuhan, China) was applied to reverse transcribe the RNA as per the manufacturer’s instructions. Eventually, relative mRNA expression was computed utilizing the 2–ΔΔCT method. The primer sequences are provided in Supplementary Table S1 .
9
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (10296010; Invitrogen, Camarillo, CA). cDNA was generated using an RT First Strand cDNA Synthesis kit (G3330; Servicebio, Wuhan, China). qRT-PCR was performed using the SYBR Premix Ex Taq (Takara) and a Roche LightCycler 480 System (Roche Applied Science, Mannheim, Germany). The primers used for the qRT-PCR assay are listed in Supplementary Table 1 . All qRT-PCR analyses were performed in triplicate. GAPDH was used for normalization, and the gene expression was analyzed according to the ΔΔCt method.
10
RT-qPCR Analysis of HLA-DMA in NSCLC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from 15 paired NSCLC tissues using TRIzol reagent (Invitrogen, Carlsbad, California, USA). The total RNA was then transcribed to cDNA using Servicebio RT First Strand cDNA Synthesis Kit (G3330; Wuhan, China) according to the manufacturer's instructions. The reverse transcription procedure was: 5 min at 25 and 42°C for 30 min and then 5 s at 85°C. Real‐time quantitative reverse transcription PCR (RT‐qPCR) was performed on a CFX96 Touch Real‐Time PCR Detection System (Bio‐Rad, China). The RT‐qPCR system contained 7.5 μL 2 × SYBR Green qPCR Master Mix, 0.75 μL forward primer, 0.75 μL reverse primer, 2 μL cDNA product, and 4.0 μL water nuclease‐free. The reaction protocol was 95°C for 30 s, followed by 40 cycles at 95°C for 15 s and 60°C for 30 s. The primers were synthesized by Servicebio (Wuhan, China). The 2−ΔCq method was used to demonstrate the expression levels of HLA‐DMA. All experiments were conducted in triplicate. The primer sequences used for RT‐qPCR were GAPDH: 5′‐GGAAGCTTGTCATCAATGGAAATC‐3′,5′‐TGATGACCCTTTTGGCTCCC‐3′; HLA‐DMA: 5′‐TGTCCAGAGGGTTTCCTATCG‐3′,5′‐CTGCCAGTTCACTGTCAGCAT‐3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!