For transient transfection using Invitrogen Lipofectamine 3000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA), the Lipofectamine 3000 Reagent was diluted in Opti-MEM medium (Thermo Fisher Scientific, Inc.), and the transfection complexes were prepared by diluting the siRNA in Opti-MEM medium. Subsequently, diluted siRNA was added to each tube of diluted Lipofectamine 3000 Reagent (1:1 ratio) and incubated for 5 min at room temperature. Different siRNA-lipid complexes (0.25 μg per well) were then added to the HeLa cells in 12 well plates (70–90% confluent, 37 °C, 5% CO2) separately, and cells were used for the subsequent experiment after transfection for 24 h. HeLa cells that were transfected with negative siRNA (Thermo Fisher), and non-siRNA were used as controls, and the BLOCK-IT Alexa Fluro Red Fluorescent Control (Thermo Fisher) with doses ranging from 0 to 50 nM was used in the pre-transfection for detecting the optimum efficiency.
Negative sirna
Manufactured by Thermo Fisher Scientific
Sourced in United States
Negative siRNA is a laboratory tool used in gene expression studies. It serves as a negative control, allowing researchers to assess the specificity of small interfering RNA (siRNA) experiments. Negative siRNA does not target any known gene, providing a baseline to compare the effects of specific siRNA knockdowns.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (5 mentions)
Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (3 mentions)
Transit qr delivery solution, by Mirus Bio (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Silox 1, by Thermo Fisher Scientific (2 mentions)
Block it alexa fluro red fluorescent control, by Thermo Fisher Scientific (1 mentions)
Opti mem medium, by Thermo Fisher Scientific (1 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Trichostatin a tsa, by Cell Signaling Technology (1 mentions)
Nup153, by Santa Cruz Biotechnology (1 mentions)
Chmp4c, by Santa Cruz Biotechnology (1 mentions)
Dharmafect 1 transfection reagent, by Horizon Discovery (1 mentions)
Nunc easyflask, by Thermo Fisher Scientific (1 mentions)
Sc 37049, by Santa Cruz Biotechnology (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Sirnas, by Santa Cruz Biotechnology (1 mentions)
14 protocols using negative sirna
1
Optimized Transient Transfection of HeLa Cells
2
SERPINC1 Knockdown in Cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In total, 2×105 cells/well were seeded in 24-well culture plates, and 0.5 ml medium without antibiotic was added in each well. Cells at 90% confluence were transfected. siRNA targeted against SERPINC1 (SERPINC1-siRNA) was purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). siRNA (50 nM) transfection was performed using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) to generate the SERPINC1-siRNA group. Negative-siRNA (Thermo Fisher Scientific, Inc.) was inserted into an empty vector (pcDNA3.1; Thermo Fisher Scientific, Inc.), which served as the empty vector control group; a non-transfected control group was also established. The sequences of the siRNAs used in the present study were as follows: SERPINC1-siRNA forward, AUCACAUUGGAAUACAUGGCC and reverse, CCAUGUAUUCCAAUGUGAUAG; Negative-siRNA forward, CAUGUGGUCUGUCGCAUAAUA and reverse, CGGUACACCAGACAGCGUAUU. Following transfection for 48 h, cells were harvested, and the efficiency of transfection was determined via RT-qPCR and western blot analysis.
3
Ulk1 Knockdown in C57BL/6N Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6N male mice (4–6 weeks old) were administered 40 μg of in vivo-ready Ulk1 (Thermo Fisher Scientific, s75753) or negative siRNA (Thermo Fisher Scientific, 4390843) every 24 h for 3 days via hydrodynamic tail-vein injection protocol using Mirus Bio TransIT-QR Delivery Solution as per manufacturer’s guidelines. All experiments were performed according to institutional animal ethics guidelines at Duke-NUS Medical School, Singapore.
4
Ulk1 Knockdown in C57BL/6N Mice
5
Rotenone-induced Oxidative Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GPx4 siRNA and negative siRNA were purchased from Thermo Fisher Scientific. H9C2 cells were transfected with either GPx4 siRNA (100 nM) or negative siRNA (100 nM) for 24 h using the LipofectamineTM 2000 transfection agent (Invitrogen, Carlsbad, CA, USA) followed by incubation with rotenone (10 µM) for an additional 24 h.
6
Knockdown of HOPX in Neonatal Rat Ventricular Cardiomyocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To knockdown HOPX expression, NRVCs were treated with siRNA (Rn01_00076610, Sigma-Aldrich, St. Louis, MO, USA) using Lipofectamine 2000 (Thermo Fisher Scientific) in optimum media (Thermo Fisher Scientific) for 3 h, and then cells were grown in 2% DMEM for 24 h. After 24 h of siRNA incubation, NRVCs were treated with ARVs or Trichostatin-A (TSA) (Cell signaling) for the next 24 h. Similarly, control cells were incubated with the negative siRNA (Thermo Fisher Scientific) and treated with ARVs and TSA.
7
ATM Knockdown and Curcumin Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To downregulate ATM expression, cells were transfected with 30 nM siRNA against ATM (siATM) or negative siRNA (Thermo Fisher Scientific, Waltham, USA) using Lipofectamine2000 (Thermo Fisher Scientific, Waltham, USA). Transfection was performed according to the manufacturer’s protocol. About 24 h after transfection medium was replaced with fresh one. Cells with silenced ATM were treated with p38 inhibitor and/or curcumin as described below.
8
Investigating Cellular Signaling Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Negative siRNA (a pool of four different siRNAs: 5′-UAAGGCUAUGAAGAGAUAC-3′, 5′-AUGUAUUGGCCUGUAUUAG-3′, 5′-AUGAACGUGAAUUGCUCAA-3′, 5′-UGGUUUACAUGUCGACUAA-3′) and human Aurora B siRNA (5′-CCAAACUGCUCAGGCAUAA-3′) were from Thermo Scientific. Human Clk1 (5′-GUAAACCUCUGAAGGAAUU-3′), Clk2 (5′-CCUUCGAUUUCCUCAAAGA-3′), Clk4 (5′-GCAAACCGUUGAAGGAAUU-3′), Clk1b (5′-GUAGACAUGUAGCAGUAAA-3′), Clk2b (5′-CAGCUCGACUUGAGAUCAA-3′), Clk4b (5′-GGAAAGGCAUGCAGUUUGU-3′), Chmp4c (a pool of three different siRNAs: 5′-GCUUGGGCUACCUAAACUA-3′, 5′-GUCAUGUGCAUACAUAGAA-3′, 5′-GUAGAGGAGUCUUAUAUGA-3′), CENP-A (a pool of three different siRNAs: 5′-GCAUGACUUUCCUCUGUAA-3′, 5′-CUAGUAAAUUCCUGUCAAA-3′, 5′-GUAUCAUAACAGUUCAGAA-3′) and Nup153 (5′-AAGGCAGACUCUACCAAAUGUUU-3′) siRNAs were from Santa Cruz Biotechnology. Only the sense sequences of the siRNA duplexes are shown and all sequences are provided in 5′→3′ orientation.
9
Silencing of Vitamin D Receptor in Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For silencing of the vitamin D receptor (VDR) ECFCs were transiently transfected with specific VDR small interfering (si) RNA (VDR silencer validated siRNA, Ambion, AM51331, Life Technologies, Darmstadt, Germany, 50 nM) or negative siRNA (Life Technologies, Carlsbad, USA), diluted in EGM +10% (v/v) FCS without antibiotics and containing Dharmafect 1 transfection reagent (Dharmacon, Darmstadt, Germany). siRNA transfection solution was added to ECFCs in a 6-well plate at 80–90% confluence. After 24 h of incubation the media was replaced with regular growth medium (EGM-2) and cells were used for further experiments. Efficiency of transfection was visualized by fluorescence staining and the VDR expression was tested by real-time RT-PCR. We confirmed a mean reduction of 64±0.14% after silencing of the VDR compared to untreated control cells, and no significant difference between non-targeting siRNA and untreated control (Figure S1 ).
10
Silencing HIF-1α and LOX in gastric cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The siRNA and nontargeting siRNA (negative siRNA) were purchased from Ambion (Life Technologies, Carlsbad, CA ,USA): HIF1A (which encodes HIF-1a) siRNA (siHIF-1a; ID s6539), siLOX#1 (ID s8254), and siLOX#2 (ID s8255). OCUM-2MD3 and OCUM-12 cells were prepared at 50-60 % confluence in six-well dishes. The transfection mixture was prepared by addition of 150 lL of Opti-MEM including 9 lL of Lipofectamine RNA iMAX reagent (Life Technologies) to 150 lL of Opti-MEM including 90 pmol of siRNA, followed by incubation for 5 min at room temperature. Finally, the transfection mixture was added to a six-well dish containing 1.7 mL of DMEM with 2 % FBS. Twenty-four hours after transfection, quantitative reverse transcription (RT) polymerase chain reaction (PCR) and Western blot were done and conditioned medium was prepared.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!