qRT-PCR was used to detect the gene expression in the glutamatergic transmission pathway and Ephrin receptor signaling. Ten hypothalamic samples RNA (n = 5 mice/group) were extracted in the TRIzol extraction protocol (Life Technologies, Carlsbad, CA, United States) according to the manufacturer’s instructions. cDNA synthesis was performed using the QuantiNovaTM reverse transcription kit (QIAGEN). Subsequently, qRT-PCR was performed using the ABI ViiA 7 RT-PCR System (Applied Biosystems, Foster City, CA, United States). A SYBR green detection system (QIAGEN) was used in reactions. The PCR amplification protocol was as follows: initial DNA polymerase activation at 95°C for 2 min, followed by 40 cycles with denaturation at 95°C for 5 s, and annealing extension at 60°C for 10 s. The 2–ΔΔCT method was applied to calculate the relative changes in gene expression using β-Actin values for normalization. Specific primers were obtained from Sangon Biotech (Shanghai, China) and are listed in Supplementary Table S1 .
Trizol extraction protocol
Manufactured by Thermo Fisher Scientific
Sourced in United States
TRIzol is a monophasic solution of phenol and guanidine isothiocyanate that is used for total RNA isolation. It is designed to extract and purify RNA from a variety of sample types, including cells, tissues, and biofluids. The TRIzol extraction protocol involves lysing and homogenizing the sample, followed by phase separation, precipitation, and washing steps to obtain purified RNA.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (3 mentions)
Lightcycler 96 system, by Roche (3 mentions)
Truseq stranded rna lt kit, by Illumina (3 mentions)
2200 tapestation instrument, by Agilent Technologies (3 mentions)
Direct zol rna miniprep kit, by Zymo Research (3 mentions)
Tapestation 2200, by Agilent Technologies (2 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Abi viia 7 rt pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green detection system, by Qiagen (1 mentions)
Quantinova, by Qiagen (1 mentions)
Hiseq 2000 platform, by Illumina (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Viia7 384 plate reader, by Thermo Fisher Scientific (1 mentions)
Hiscribe t7 kit, by New England Biolabs (1 mentions)
Serum free media, by Thermo Fisher Scientific (1 mentions)
Rnazol, by Merck Group (1 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Gotaq dna polymerase, by Promega (1 mentions)
Protoscript first strand cdna synthesis kit, by New England Biolabs (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
24 protocols using trizol extraction protocol
1
Quantitative Analysis of Glutamatergic and Ephrin Pathways
2
Trizol-based RNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using the Trizol extraction protocol from the manufacturer (Life Technologies). Library preparation and sequencing of HIOs was performed in the University of Michigan DNA Sequencing Core on the Illumina Hi-Seq 2000 platform using TruSeq library preparations. The Bioinformatics Core at the University of Michigan processed all RNA-seq data. See the Supplemental Experimental Procedures for a detailed description of methods and for details regarding informatics analysis. All data and analyses are available online (https://github.com/hilldr/Finkbeiner_StemCellReports2015 ).
3
Yeast RNA Extraction via Trizol and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction from yeast cells was performed by glass-bead disruption employing the Trizol extraction protocol (Life Technologies, Bleiswijk, The Netherlands). Six OD units of yeast cells from the exponential phase were harvested and mixed with 0.2 mL glass beads (diameter 0.45 mm), 900 μL Trizol and 125 µL chloroform. Next, the cells were disrupted with a Fastprep FP120 (Thermo Savant) for 45 s at speed 6. Extracted total RNA (500 ng) was used for reverse transcription to synthesize cDNA by using the iScript cDNA synthesis Kit (Bio-rad, CA, USA).
4
Gene Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from frozen tissues following TRIzol extraction protocol (Life Technologies). 500 ng of RNA were retrotranscribed into cDNA (SSIII cDNA production kit, Thermo Fisher Scientific). qPCR was performed on 1/10 diluted cDNA, using ViiA7 384-plate reader (Thermo Fisher Scientific). Final primers concentration 100 nM, final reaction volume 10 µl, PGK and GAPDH as internal reference; thermal profile 95 °C 15 seconds, 60 °C 60 seconds, 40x. Primers are listed in Table 2 . Data are shown as relative expression normalized on respective organ of local injections.
List of primers used.
| Genes | Forward | Reverse |
|---|---|---|
| PGK | ATGCAAAGACTGGCCAAGCTAC | AGCCACAGCCTCAGCATATTTC |
| GAPDH | CAACTCCCTCAAGATTGTCAGCAA | GGCATGGACTGTGGTCATGA |
| eGFP | CATGGTCCTGCTGGAGTTCGTG | CGTCGCCGTCCAGCTCGACCAG |
5
Gene Expression Analysis of Rat Brain Areas
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Brain area samples from individual rats were homogenized in 150 μl Trizol and then 600 μl Trizol was added to final volume of 750 ml. Samples were stored at −80 or −20°C until RNA extraction. For microarray analysis, from 4 to 6 biological replicas (animals) were prepared as above for each brain area Control or Vinclozolin group depending on samples availability (Additional file 2 : Table S1B). A total of 132 (67 Control and 65 Vinclozolin) samples/chips were analyzed: (6 brain areas) × (2 Male or Female) × (2 Control or Vinclozolin) × (4–6 biological replicas). RNA from individual animal brain area was extracted from Trizol samples according to standard Trizol extraction protocol (Invitrogen, USA) and stored in aqueous solution at −80°C until microarray analysis.
6
RNA Extraction and Quality Assessment
7
RNAi Knockdown of Target Genes in Drosophila
8
Quantitative RT-PCR Analysis of Injury Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was extracted from homogenized tissues using the TRIzol® extraction protocol (Invitrogen; Thermo Fisher Scientific, Inc.) and reverse transcribed using the ProtoScript® First Strand cDNA Synthesis kit (New England BioLabs, Inc.) according to the manufacturer's instructions. Primer sets for RT-qPCR (Table I ) were used to amplify target regions from cDNA as templates using the GoTaq DNA polymerase (Promega Corporation). For qPCR, the PowerUp SYBR Green Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used to measure ERP72, ICAM1, VCAM1, and SELE gene expression levels 15, 30, 90 and 120 min post-injury. Fluorescence was monitored for 40 cycles (95°C for 3 sec, 60°C for 30 sec) on a 7500 fast real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). Experiments were run in triplicates for all groups. The data were quantified using the 2−ΔΔCq method (40 (link)), and the results are presented as the fold change relative to GAPDH, using the untreated control group as reference.
9
Tissue Sampling and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumor tissue and tumor-adjacent tissue were collected at the time of surgical resection. All the samples were immediately snap-frozen in liquid nitrogen and stored at −170 °C before use. Total RNA was extracted following a TRIzol extraction protocol (Invitrogen, USA).
10
Gly-tRF Quantification in Hepatic Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from hepatic tissues or AML12 cells according to the TRIzol extraction protocol (Invitrogen). Gly-tRFs were assayed according to a previously described method.13 (link) RNA transcript levels were measured by qRT-PCR, using a SYBR Green PCR master mix (Bio-Rad). All experiments were performed in triplicate. The primers used in this study are shown in Supplementary information, Table S1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!