DNA methylation analysis was performed at single-base resolution using the bisulfite pyrosequencing method as previously described (Kundakovic et al., 2013a (link)). Briefly, 250 ng of genomic DNA was used for bisulfite conversion (EpiTect Bisulfite Kit, Qiagen) and 20 ng of bisulfite converted DNA was run in a PCR using the PyroMark PCR kit (Qiagen) and primers for genes of interest, one of which was biotinylated at the 5′ end. Biotinylated PCR products were processed on a vacuum workstation and pyrosequencing was performed on an Advanced PyroMark Q24 pyrosequencer using the advanced CpG reagents (Qiagen) and a specific sequencing primer. PCR and pyrosequencing primers for the mouse Nr3c1 and Cacna1c genes are presented in Supplementary Table S2 . Methylation levels of single CpG sites were quantified using PyroMark Q24 Advanced software (Qiagen).
Advanced cpg reagents
Manufactured by Qiagen
The Advanced CpG Reagents are a set of high-quality reagents designed for DNA methylation analysis. These reagents facilitate the detection and quantification of DNA methylation patterns, which are essential for understanding epigenetic mechanisms and gene regulation.
Automatically generated - may contain errors
Lab products found in correlation
Pyromark q24 system, by Qiagen (4 mentions)
Ez methylation kit, by Zymo Research (3 mentions)
Pyromark pcr kit, by Qiagen (2 mentions)
Pyromark q24 advanced software, by Qiagen (1 mentions)
Epitect bisulfite kit, by Qiagen (1 mentions)
Humanmethylation450 array, by Illumina (1 mentions)
Pyromark q48 autoprep, by Qiagen (1 mentions)
Pyromark q48 autoprep system, by Qiagen (1 mentions)
Pyromark q48 autoprep 2, by Qiagen (1 mentions)
Veriti thermocycler, by Thermo Fisher Scientific (1 mentions)
6 protocols using advanced cpg reagents
1
Bisulfite Pyrosequencing for DNA Methylation
2
Validating Infinium Methylation Array Data
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We examined bisulfite-converted genomic DNA (EZ methylation kit by Zymo Research) by quantitative pyrosequencing analysis to confirm results from the Infinium Methylation arrays. Validation of methylation levels using pyrosequencing was performed on 20 cases and 15 controls. We performed pyrosequencing with appropriate oligos using the PyroMark Q24 System and advanced CpG Reagents (Qiagen®) as per the manufacturer’s instructions. We confirmed methylation difference of top 25 CpG targets, concluding the chip-based cytosine methylations are true changes [57 (link),58 (link)]. A detailed methodology was published previously [57 (link)].
3
Validating Methylation Differences by Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the results obtained from the Illumina HumanMethylation450 arrays, we performed pyrosequencing analysis of bisulphite-converted DNA with appropriate oligos using the PyroMark Q24 System and advanced CpG Reagents (Qiagen ®).
The p-value for methylation differences between case and normal groups at each locus was calculated as previously described [32 (link)]. Filtering criteria for p-values were set at <0.05 and also <0.01 in order to identify the most differentiating cytosines. P-values were calculated with and without Benjamini and Hochberg False Discovery Rate (FDR) correction for multiple testing [33 ]. The Benjamini and Hochberg correction tolerates more false positive genes than the Bonferroni correction.
Further analysis of the differentially methylated genes was conducted for potential biological significance. ROC curves and ROC AUC were calculated to determine the diagnostic accuracy of specific cytosine loci to differentiate AVS from control groups. Data were normalized using the Controls Normalization Method.
The p-value for methylation differences between case and normal groups at each locus was calculated as previously described [32 (link)]. Filtering criteria for p-values were set at <0.05 and also <0.01 in order to identify the most differentiating cytosines. P-values were calculated with and without Benjamini and Hochberg False Discovery Rate (FDR) correction for multiple testing [33 ]. The Benjamini and Hochberg correction tolerates more false positive genes than the Bonferroni correction.
Further analysis of the differentially methylated genes was conducted for potential biological significance. ROC curves and ROC AUC were calculated to determine the diagnostic accuracy of specific cytosine loci to differentiate AVS from control groups. Data were normalized using the Controls Normalization Method.
4
Quantifying Cytosine Methylation in TNF Exon 1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The methylation of four Cytosine‐Guanine dinucleotides (CpG) sites (+197, +202, +214 and +222 base pairs from the transcription start site) within Exon 1 of the TNF were measured using pyrosequencing (PyroMark Q48 Autoprep System, Qiagen). The extracted bisulfite converted DNA was amplified using the PyroMark PCR kit (Qiagen) in a Veriti thermocycler (Applied Biosystems) using primers (Forward PCR Primer 5′‐GGAAAGGATATTATGAGTATTGAAAGTATG‐3′; Reverse PCR Primer 5′‐biotin‐CTAAAACCCCCCTATCTTCTTAAA‐3′ and Sequencing Primer 5′‐ATTATGAGTATTGAAAGTATGAT‐3′).
PCR product was used for CpG quantification with the PyroMark Q48 Autoprep (Qiagen) using Advanced CpG Reagents (Qiagen) in accordance with the manufacturer's protocol. The assay covered the methylation sites +197, +202, +214 and +222 base pairs from the transcription start site of TNF. In this manuscript, these sites are designated as CpG1 to CpG4 for data analysis and inferences. The percentage methylation of the four CpG sites was calculated within the software (PyroMark Q48 Autoprep 2.4.1 Software, Qiagen) and the methylation percentages were exported for further analysis.
PCR product was used for CpG quantification with the PyroMark Q48 Autoprep (Qiagen) using Advanced CpG Reagents (Qiagen) in accordance with the manufacturer's protocol. The assay covered the methylation sites +197, +202, +214 and +222 base pairs from the transcription start site of TNF. In this manuscript, these sites are designated as CpG1 to CpG4 for data analysis and inferences. The percentage methylation of the four CpG sites was calculated within the software (PyroMark Q48 Autoprep 2.4.1 Software, Qiagen) and the methylation percentages were exported for further analysis.
5
Quantitative DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To further validate the array data, we used pyrosequencing to analyze the DNA methylation status of the most significant CpG sites. We performed pyrosequencing analysis of bisulphite-converted DNA with appropriate oligos using the PyroMark Q24 System and advanced CpG Reagents (Qiagen®). Briefly, 500 ng of genomic DNA from each sample was bisulfite-treated using the EZ methylation kit (Zymo Research) as per the manufacturer’s instructions and amplified by a bisulfite polymerase chain reaction, followed by Quantitative DNA methylation analysis of each CpG.
6
Validating Methylation Variants via Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pyrosequencing was performed to verify the variable methylation status of important methylation variants, to determine that CHIP hybridizations were not artifacts but the true methylation differences. Forty-eight targets with AUC ≥ 0.9 were chosen for validation, comprising the 53 genes with the most significant methylation variation (p < 0.00001). 2 µg of genomic DNA was bisulfite-treated using the EZ methylation kit (Zymo Research) per the manufacturer’s instructions and sequencing was performed with appropriate oligos using the PyroMark Q24 System and advanced CpG reagents (Qiagen). An additional analysis replicated the top-25 differently methylated CpG sites in an independent second cohort of 24 high myopia cases and matched 24 controls and confirmed the top-ranking differentially-methylated CpG sites in whole blood DNA of our cohort samples.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!