NR8383 and RAOEC cells (Sigma-Aldrich, St. Louis, MO, USA) were simultaneously transfected using the miR-107 mimic or mimic NC and pGL3-MEG8 wild-type (WT) or pGL3-MEG8-mutated (Mut) luciferase construct vectors (Miltenyi Biotec, Auburn, CA, USA), respectively. Luciferase activity was analyzed 24 h post-transfection by using the luciferase report analysis system (Promega, Madison, WI, USA).
Luciferase report analysis system
Manufactured by Promega
Sourced in United States
The Luciferase report analysis system is a laboratory equipment designed to measure and analyze luciferase reporter activity. It provides a quantitative assessment of gene expression by detecting and quantifying luminescent signals generated by luciferase-based reporter assays.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using luciferase report analysis system
1
Regulation of MEG8 by miR-107
2
Luciferase reporter assay for BCL2L11 3'-UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BCL2L11 3'‐UTR was amplified by PCR. Mutant 3'‐UTR was generated by QuikChange II XL site‐directed mutagenesis kit (Stratagene). The wild‐type BCL2L11 3'‐UTR (BCL2L11‐WT, UCUAUGAAUUGUAGAAGUAUUC) and the mutant‐type BCL2L11 3'‐UTR (BCL2L11 mutant, UCUAUGAAUUGUAGACAGCGGC) were cloned into the downstream of the coding region of the luciferase gene. The constructed vector was co‐transfected with miR‐200b‐3p mimic or mimic NC into 293T cells through Lipofectamine 3000 (Invitrogen). The luciferase report analysis system (Promega) was utilized to measure the luciferase activity.31
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!