Total RNA was isolated from tissues or organoids with Trizol (Invitrogen). cDNA was synthesized, and gene expression was quantified by real-time PCR with SYBR Green (Diagenode) and an ABI 7900. Gene expression levels were normalized to 36B4 or Actin. For microarray analysis, RNA from isolated crypts was pooled from n = 5 biological replicates and processed in the UCLA Microarray Core Facility with Gene-Chip Mouse Gene 430.2 Arrays (Affymetrix). Data analysis was performed with GenespringGX (Agilent).
Sybr green
Manufactured by Diagenode
SYBR Green is a fluorescent dye used for detecting and quantifying DNA in various laboratory applications. It binds to double-stranded DNA, emitting a strong fluorescent signal upon excitation, allowing for the visualization and measurement of DNA concentration.
Automatically generated - may contain errors
Lab products found in correlation
Cfx96 system, by Bio-Rad (2 mentions)
Dreamtaq polymerase, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Genespring gx, by Agilent Technologies (1 mentions)
Gene chip mouse gene 430.2 arrays, by Thermo Fisher Scientific (1 mentions)
Bioruptor, by Diagenode (1 mentions)
4 protocols using sybr green
1
Transcriptional Profiling of Organoids
2
Chromatin Immunoprecipitation (ChIP) Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP experiment was performed as described (Villanueva et al., 2011 (link)). Cells were crosslinked in DSG (disuccinimidyl glutarate) and 1% formaldehyde for 10 min and quenched with 2 M Glycine. Lysed cells were sonicated using a Bioruptor (Diagenode) according to the manufacturer's protocol, and chromatin was immunoprecipitated with antibodies against p65 (Santa Cruz C-20) or IgG (PP64, Millipore) overnight at 4°C for overnight in the presence of Protein A beads with salmon sperm DNA (Millipore). DNA enrichment was quantified by real-time PCR using SYBR Green (Diagenode) and an ABI 7900 instrument. Occupancy was normalized to input DNA. Primer sequences are given in Table 2 .10.7554/eLife.08009.021
ChIP primers
| Murine ChIP primers | Forward | Reverse |
|---|---|---|
| Hbb2 | AGGTGCACCATGATGTCTGT | AGCAGGGTCAGTTGCTTCTT |
| Il-1b | GGACAATTGTGCAGATGGTG | CCTACCTTTGTTCCGCACAT |
| iNos | GGAGTGTCCATCATGAATGAG | CAACTCCCTGTAAAGTTGTGACC |
| Mcp-1 | TCCAGGGTGATGCTACTCCT | AGTGAGAGTTGGCTGGTGCT |
3
Allele-specific qPCR Detection of uL11 Mutation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forward allele-specific primers with 3’ end matching either wild-type (LNAWT) or mutated 3rd codon (LNAK3A) of uL11 (AAA or GCC, respectively) and a Locked Nucleic Acid (LNA) nucleotide [24 (link)] at the second position of the mismatch codon were used in combination with a reverse primer (CRISPR1_R) to amplify a 219 nucleotide fragment (S1 Table ). 25 μL reactions were set to contain 5 to 15 ng of genomic DNA, 0.5 μM forward and reverse primers, 0.4 nM dNTP, 0.75 μL SYBR green (Diagenode), and 2.5 units of DreamTaq polymerase (Thermo Fisher Scientific) in TMAC buffer (67 mM Tris pH 8.8, 6.7 mM MgCl2, 16.6 mM ammonium sulfate, 0.5 mM tetramethylammonium chloride, 0.17 mg/mL BSA) [25 (link)]. 0.5 ng of plasmid containing the uL11 coding region in which the AAA lysine 3 codon was replaced by GCC was used as positive control. qPCR reactions were carried out in a CFX96 system (BioRad) [95°C 3 min; 40 cycles (95°C 20 s, 64°C 20 s, 72°C 30 s)]. To confirm the presence of the mutated allele, a 1.5 kb region centred on the lysine 3 codon was sequenced.
4
Detecting Lysine 3 Mutation in uL11 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forward allele-specific primers with 3' end matching either wild-type (LNAWT) or mutated 3 rd codon (LNAK3A) of uL11 (AAA or GCC, respectively) and a Locked Nucleic Acid (LNA) nucleotide (23) at the second position of the mismatch codon were used in combination with a reverse primer (CRISPR1_R) to amplify a 219 nucleotide fragment (Supplementary Table 1). 25 μL reactions were set to contain 5 to 15 ng of genomic DNA, 0.5 μM forward and reverse primers, 0.4 nM dNTP, 0.75 μL SYBR green (Diagenode), and 2.5 units of DreamTaq polymerase (Thermo Fisher Scientific) in TMAC buffer (67 mM Tris pH 8.8, 6.7 mM MgCl2, 16.6 mM ammonium sulfate, 0.5 mM tetramethylammonium chloride, 0.17 mg/mL BSA) (24) . 0.5 ng of plasmid containing the uL11 coding region in which the AAA lysine 3 codon was replaced by GCC was used as positive control. qPCR reactions were carried out in a CFX96 system (BioRad) [95°C 3 min; 40 cycles (95 °C 20 s, 64 °C 20 s, 72 °C 30 s)]. To confirm the presence of the mutated allele, a 1.5 kb region centred on the lysine 3 codon was sequenced.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!