Qpcr core kit

Manufactured by Eurogentec

Sourced in Belgium, United Kingdom

The QPCR Core Kit is a collection of essential reagents for performing quantitative real-time polymerase chain reaction (qPCR) analysis. The kit includes a high-performance DNA polymerase, reaction buffer, and other necessary components to enable efficient and accurate gene expression quantification.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

QPCR Core kit for SYBR Green I (27 citations) QPCR Core kit for SYBR Green I No ROX (8 citations) QPCR Core kit for SYBR Green (6 citations) QPCR SYBR Green Core Kit (4 citations) QPCR core kit for SYBR green I with low ROX passive reference (2 citations)

14 protocols using qpcr core kit

Comprehensive Transcriptome Analysis Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA samples were purchased from Ambion Life Technologies, or prepared from cell lines and surgical specimens (obtained from the Ludwig Institute for Cancer Research, Belgium) using either TriPure Isolation Reagent (Roche Diagnostics GmbH) or the guanidinium-isothiocyanate/cesium chloride procedure.³⁸ Reverse transcription was performed on 2 μg of total RNA using either PrimeScript Reverse transcriptase (Takara) and random hexamers primers, or M-MLV Reverse transcriptase (Invitrogen) and dT18 primers. The transcripts were amplified from 1/40 of the reverse transcription reaction. Conventional PCRs were performed using the DreamTaq polymerase (Thermo Fisher Scientific), in a final reaction volume of 25 μl. Quantitative RT-PCR amplifications were performed using the qPCR Core kit (Eurogentec). All qPCRs where SybrGreen assays, except for the GABRA3 qPCR, which was a Taqman assay. Primers and probe sequences are listed in the table S2.
For miRNA RT-qPCR analyses, 20ng of total RNA was used for the RT with the Universal cDNA Synthesis Kit II (Exiqon). miRNAs were amplified from 1/320 of the reverse transcription reaction, using LNA primers specific for hsa-mir-767–5p (#204238, Exiqon) and hsa-mir-105–5p (#204389, Exiqon). LNA primers specific for SNORD44 (#203902, Exiqon) were used for normalization. qPCR was performed using the qPCR Core kit (Eurogentec).

Loriot A., Van Tongelen A., Blanco J., Klaessens S., Cannuyer J., van Baren N., Decottignies A, & De Smet C. (2014). A novel cancer-germline transcript carrying pro-metastatic miR-105 and TET-targeting miR-767 induced by DNA hypomethylation in tumors. Epigenetics, 9(8), 1163-1171.

+ Open protocol

+ Expand

Quantitative PCR for TCR Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated either using the AllPrep DNA/RNA/Protein mini kit (Qiagen) or QIAamp DNA Micro Kit (Qiagen) following manufacturer's instructions. Samples were run on a 7900HT RT-PCR System of Applied Biosystems. The following vector-specific HA1 TCR primers were used; forward primer resides in the optimized constant domain of the beta chain 5′ CTGTACGCCGTGCTGGTG 3′, reverse primer resides in the T2A region 5′ GGGATTCTCCTCCACGTCACC 3′ and the antisense probe also resides in the T2A region 5′ TGTTAGAAGACTTCCTCTGCCCTC 3′. The Probe used VIC as dye and TAMRA as quencher. Each sample was run in duplicate with 200 ng genomic DNA per well (qPCR core kit Eurogentec) at 65°C for 50 cycles.

van Balen P., Jedema I., van Loenen M.M., de Boer R., van Egmond H.M., Hagedoorn R.S., Hoogstaten C., Veld S.A., Hageman L., van Liempt P.A., Zwaginga J.J., Meij P., Veelken H., Falkenburg J.H, & Heemskerk M.H. (2020). HA-1H T-Cell Receptor Gene Transfer to Redirect Virus-Specific T Cells for Treatment of Hematological Malignancies After Allogeneic Stem Cell Transplantation: A Phase 1 Clinical Study. Frontiers in Immunology, 11, 1804.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation from murine or human liver tissues was done essentially as described before 20 . Total RNA was quantified and 2 μg samples each were reverse transcribed using the Superscript II reverse transcriptase and random hexamer primers (both from Invitrogen, Life Technologies, Darmstadt, Germany). For the individual TaqMan PCR assays, the cDNA derived from 25 ng RNA was amplified in a total volume of 25 μl using the qPCR Core Kit (Eurogentec, Cologne, Germany) and primer combinations listed in Table S2. The amplification of all murine (IL-1β, TNF-α, NLRP3, ASC, TIMP-1, MMP-9 and GAPDH) or human (IL-1β, NLRP3, ATP7b, caspase-1, TNF-α, ASC, TIMP-1, MMP-9 and GAPDH) target gene sequences was done under the following conditions: initial melting phase at 95°C for 10 min., followed by 40 cycles at 95°C for 15 sec. and 60°C for 1 min. respectively. All samples were normalized to the expression of GAPDH measured in the same sample.

Boaru S.G., Merle U., Uerlings R., Zimmermann A., Flechtenmacher C., Willheim C., Eder E., Ferenci P., Stremmel W, & Weiskirchen R. (2015). Laser ablation inductively coupled plasma mass spectrometry imaging of metals in experimental and clinical Wilson's disease. Journal of Cellular and Molecular Medicine, 19(4), 806-814.

+ Open protocol

+ Expand

Quantitative Analysis of Transgene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA and RNA were isolated from stable transfected cells. RNA was isolated with TRIzol Reagent (Life Technologies) according to the manufacturer's instructions. RNA integrity was assessed by loading each sample to a MOPS gel. RNA was treated with DNaseI (Thermo Fisher Scientific) prior to reverse transcription by RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). Genomic DNA was isolated by QIAamp DNA Blood Mini kit (Qiagen) according to the manufacturer's instructions.
IgG-Fc DNA and cDNA were detected by a TaqMan assay. As a genomic control Actb was used. TaqMan probes as well as qPCR Core kit were ordered from Eurogentec. PG9 antibody heavy and light chain DNA and cDNA were detected by a Sybr Green assay. We used Taq polymerase from 5PRIME for this assay. Primers were ordered from Eurofins Genomics. As a template 5 ng genomic DNA or cDNA derived from 50 ng total RNA was used per reaction in a 25 μl final volume. See probe and primer sequences under the headline ‘Primer and probe list’.

Zboray K., Sommeregger W., Bogner E., Gili A., Sterovsky T., Fauland K., Grabner B., Stiedl P., Moll H.P., Bauer A., Kunert R, & Casanova E. (2015). Heterologous protein production using euchromatin-containing expression vectors in mammalian cells. Nucleic Acids Research, 43(16), e102.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Cytokine Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Th/+ CCR2^+/+ or Th/+ CCR2^−/− mice were perfused with PBS 2 days after stereotactic cytokine injection. Brains were dissected and the ipsilateral cortex near the injection site was separated from the white matter and conserved in QIAzol Lysis Reagent (Qiagen). RNA was isolated from the tissue using the RNeasy Micro Kit (Qiagen, Germany) and subsequently transcribed into cDNA using the High Capacity RNA-to-cDNA™ Kit (Life Technologies). From the cDNA, 12.5 ng were used per PCR reaction. Quantitative PCR was performed on the iQ5™ Real Time PCR Detection System (BIO-Rad) using the qPCR Core Kit obtained from Eurogentec. The following FAM labeled primers/probes (TaqMan^® Gene Expression Assays) were selected to be intron spanning from Life Technologies: Gapdh (Mm99999915 g1), TNF-α (Mm00443258_m1), NOS2/iNOS (Mm00440502_m1) and CCL2 (Mm00441242_m1). The expression levels of TNF-α, NOS2/iNOS and CCL2 are indicated as the percentage of the housekeeping gene Gapdh.

Lagumersindez-Denis N., Wrzos C., Mack M., Winkler A., van der Meer F., Reinert M.C., Hollasch H., Flach A., Brühl H., Cullen E., Schlumbohm C., Fuchs E., Linington C., Barrantes-Freer A., Metz I., Wegner C., Liebetanz D., Prinz M., Brück W., Stadelmann C, & Nessler S. (2017). Differential contribution of immune effector mechanisms to cortical demyelination in multiple sclerosis. Acta Neuropathologica, 134(1), 15-34.

+ Open protocol

+ Expand

qPCR Analysis of Differentially Expressed Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four of the genes significantly different between F and EF plants on the microarray were analyzed in the RNA of all individual plants by qPCR analysis as described previously [11 (link)]. In brief, cDNA was synthesized with the Reverse Transcriptase Core kit and subjected to SYBR^®Green-based real-time PCR using the qPCR core kit (bothta kits: Eurogentec, Seraing, Belgium, http://www.eurogentec.com) and gene specific primers (Supplementary Material: Table S3) on a Stratagene™ Mx3005P^® instrument (Agilent Technologies, Santa Clara, CA, USA, http://www.agilent.com).

Geuss D., Lortzing T., Schwachtje J., Kopka J, & Steppuhn A. (2018). Oviposition by Spodoptera exigua on Solanum dulcamara Alters the Plant’s Response to Herbivory and Impairs Larval Performance. International Journal of Molecular Sciences, 19(12), 4008.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Antioxidant Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The qPCR reactions were performed using the qPCR Core Kit and uracyl N‑glycosylase (both from Eurogentec, Cologne, Germany). Transcripts were detected with TaqMan Assays (Applied Biosystems, Darmstadt, Germany) for βActin (Mm00607939_s1), NQO1 (Mm0125356_m1) and PRDX2 (Mm04208313_g1). A total amount of 10 ng cDNA was used for each reaction (20 µL). ΔC_t was calculated as difference between the C_t of the gene of interest (NQO1 or PRDX2) and the C_t of the used housekeeping gene (βActin). To calculate the ΔΔC_t, the ΔC_t of untreated cells was subtracted from the ΔC_t of GOD treated cells.

Voigt D., Scheidt U., Derfuss T., Brück W, & Junker A. (2017). Expression of the Antioxidative Enzyme Peroxiredoxin 2 in Multiple Sclerosis Lesions in Relation to Inflammation. International Journal of Molecular Sciences, 18(4), 760.

+ Open protocol

+ Expand

Cytokine Expression in Preadipocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proteins were extracted from the preadipocytes, and content measured as previously described.13 (link) The concentrations of interleukin (IL)-1β, IL-6, IL-8, monocyte chemoattractant protein (MCP)-1 and regulated on activation, normal T cell expressed and secreted (RANTES) in the supernatant were measured independently in duplicate using human ELISA kits following the manufacturer’s instructions (R&D Systems, UK) and SPECTROstar Nano Microplate Reader (BMG LABTECH, Germany), normalized to the total cell protein and presented as ng(cytokine)/mg(cell protein).
RNA was extracted from Trizol-lysed preadipocytes and converted to cDNA using cDNA synthesis kit (Bio-Rad, UK). The relative gene expression of IL-1β, IL-6, IL-8, MCP-1 and RANTES were measured as Ct value independently in duplicate using TaqMan gene expression assays (Applied Biosystems, UK), qPCR core kit following the manufacturer’s instructions (Eurogentec, Belgium) and Stratagene Mx3005P instrument system, normalized to the internal reference PPIA,14 (link) and presented as fold change relative to control using the 2^−ΔΔct formula.15 (link)

Zhu J, & Wilding J.P. (2020). The 1α,25(OH)2D3 Analogs ZK159222 and ZK191784 Show Anti-Inflammatory Properties in Macrophage-Induced Preadipocytes via Modulating the NF-κB and MAPK Signaling. Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy, 13, 1715-1724.

+ Open protocol

+ Expand

Chlamydial Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the analysis of chlamydial gene expression, infected cells were harvested at different time points and real-time PCR was performed targeting the 16S rRNA gene as described previously [34 (link)]. To analyse chlamydial developmental phase, expression of genes euo, ompA and omcB were performed. All the primers were ordered from Eurofins MWG Operon (Additional file 1: Figure S1). Briefly, total RNA was isolated from the cell pellets of infected monocytes or DCs using the Macherey Nagel kit (Macherey-Nagel GmbH, Dueren, Germany). 500 nanogram of RNA was reverse-transcribed from each sample using the Eurogentec Reverse-Transcription Kit. Real-time PCR was performed using the qPCR Core kit (Eurogentec) in Roche Lightcycler 480 system. The gene expression levels were calculated by the delta-delta Ct (ddCt) method [41 (link)], normalized to 16S in case of chlamydial genes and to 18S for host genes, and compared to the mock sample as the reference gene. The specificity and identity of the amplified products were determined using Light Cycler 480 melting curve analysis software. Data from 3 independent experiments with pool of 2 donors were combined to calculate the mean and standard deviation.

Datta B., Njau F., Thalmann J., Haller H, & Wagner A.D. (2014). Differential infection outcome of Chlamydia trachomatis in human blood monocytes and monocyte-derived dendritic cells. BMC Microbiology, 14, 209.

+ Open protocol

+ Expand

Quantifying Oligodendrocyte Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

To assess relative mRNA expression levels, qPCR of striatal tissue was performed. Total RNA was isolated from fresh brain tissue using the RNeasy Micro Kit (Qiagen). RNA was isolated 3 (n = 5), 7 (n = 5), 14 (n = 3) and 21 (n = 3) dpc from the striatal lesion, as well as from healthy controls (n = 3). The mRNA was transcribed into cDNA using the High Capacity RNA-to-cDNA™ Kit (Life Technologies) according to the manufacturer’s instructions. Furthermore, cDNA was used for qPCR using the qPCR core kit (Eurogentec). The following TaqMan™ primers were obtained from Thermo Fisher Scientific (USA) and used as indicated by manufacturer’s protocol: Olig2 (Rn01767116_m1), MAG (Rn01457782_m1), GAPDH (Rn01775763_g1). Relative expression of oligodendrocyte-specific genes Olig2 and MAG was normalized to mean oligodendrocyte densities at the respective time point.

Lohrberg M., Winkler A., Franz J., van der Meer F., Ruhwedel T., Sirmpilatze N., Dadarwal R., Handwerker R., Esser D., Wiegand K., Hagel C., Gocht A., König F.B., Boretius S., Möbius W., Stadelmann C, & Barrantes-Freer A. (2020). Lack of astrocytes hinders parenchymal oligodendrocyte precursor cells from reaching a myelinating state in osmolyte-induced demyelination. Acta Neuropathologica Communications, 8, 224.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!