Ready to go dna labeling beads

Manufactured by GE Healthcare

Sourced in Germany

Ready-to-Go DNA-labeling beads are a tool used for labeling DNA samples. The beads contain pre-loaded enzymes and reagents necessary for the DNA labeling process, allowing for a simplified and standardized workflow.

Automatically generated - may contain errors

Lab products found in correlation

32p dctp, by PerkinElmer (2 mentions) Northernmax kit, by Thermo Fisher Scientific (1 mentions) Anti p53 fl393, by Santa Cruz Biotechnology (1 mentions) C digit blot scanner, by LI COR (1 mentions) Pierce ecl plus western blotting substrate, by Thermo Fisher Scientific (1 mentions) Storm 860 phosphorimager, by GE Healthcare (1 mentions) Turboblotter, by GE Healthcare (1 mentions) Anti β actin antibody c4, by Santa Cruz Biotechnology (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Protease inhibitor cocktail, by Merck Group (1 mentions) Hybond n, by GE Healthcare (1 mentions) Chef mapper, by Bio-Rad (1 mentions) Hybond n nylon membrane, by GE Healthcare (1 mentions) Cyclone plus phosphor imager, by PerkinElmer (1 mentions) Positively charged nylon membrane, by GE Healthcare (1 mentions) Fastprep system, by Qbiogene (1 mentions) Rneasy mini kit, by Qiagen (1 mentions)

6 protocols using ready to go dna labeling beads

Temperature-Induced RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bacterial strains were inoculated as described above, and grown at 37 °C until the cultures reached OD₆₀₀ = 0.7 +/− 0.1(T = 0). At this point, the cultures were subsequently transferred to a water bath at 28 °C. At T = 0, T = 10 min and T = 30 min following the temperature shift, 1 ml samples were withdrawn for the isolation of RNA. The RNA extraction was performed as described above and Northern blotting was performed as described previously^{20 (link)}. Briefly, 5 µg of RNA from each preparation was loaded onto a 1% agarose gel and separated in 10 mM sodium phosphate buffer as described previously. RNA was transferred to a positively charged nylon membrane by capillary blotting. The hybridization was performed using a [³²P] labeled clpX-specific probe, amplified with clpX-f: 5′-GCTGTGGCTGTTTATAACCAC and clpX-r: 5′-GTGCTGTAATAACTACCTTCG primers, and labeled with [³²P]dCTP (Perkin-Elmer) using the Ready-to-Go DNA-labeling beads from GE-healthcare.

Jensen C., Fosberg M.J., Thalsø-Madsen I., Bæk K.T, & Frees D. (2019). Staphylococcus aureus ClpX localizes at the division septum and impacts transcription of genes involved in cell division, T7-secretion, and SaPI5-excision. Scientific Reports, 9, 16456.

+ Open protocol

+ Expand

Northern and Western Blotting of MEG3 and p53

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Northern blotting, total RNAs were isolated using TRIzol reagent according to the manufacture's instruction (Life Technology). Northern blotting was performed to detect MEG3 transcripts using the NorthernMax kit from Life Technology. Ten µg total RNA for each sample was loaded with dye containing ethidium bromide on 1.5% agarose gel. After electrophoresis, resolved RNAs were transferred to a Nytran membrane using a TurboBlotter from GE Healthcare (Pittsburgh, PA). The membrane was hybridized with MEG3 cDNA probe labeled with [α-³²P]dCTP using the Ready-To-Go DNA Labeling Beads from GE Healthcare. After washing, the membrane was exposed to a storage phosphor screen and analyzed by GE Storm 860 phosphor imager. The membrane was then stripped and re-probed to detect GAPDH as the internal control.
For Western blotting, total protein was isolated by lysis of cells with RIPA buffer containing protease inhibitor cocktail from Sigma Aldrich (P8340). Ten µg of total protein was resolved by 10% SDS-PAGE. After transfer to a PVDF membrane, the blot was probed with anti-p53 (FL393, Santa Cruz Biotechnology, Santa Cruz, CA) or anti-β-actin antibody (C4, Santa Cruz Biotechnology). P53 and β-actin were detected using Pierce ECL Plus Western blotting substrate (LifeTechnology) on a C-DiGit blot scanner (LI-COR Biotechnology, Lincoln, NE).

Chunharojrith P., Nakayama Y., Jiang X., Kery R.E., Ma J., De La Hoz Ulloa C.S., Zhang X., Zhou Y, & Klibanski A. (2015). Tumor Suppression by MEG3 lncRNA in a Human Pituitary Tumor Derived Cell Line. Molecular and cellular endocrinology, 416, 27-35.

+ Open protocol

+ Expand

Long-range DNA Separation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For long range DNA separation, genomic DNA was prepared using standard methods. Agarose-embedded DNA was digested overnight with 40 units of the selected restriction endonuclease. Digested DNA was separated using a Bio-Rad Chef Mapper; run conditions are described in the figure legend. Agarose gels were blotted onto Hybond-N+ (GE Healthcare) using standard methods. DNA probes were labelled with Ready-To-Go DNA Labeling Beads (GE Healthcare) incorporating dCTP alpha³²P (Perkin Elmer). Blots were hybridised in 5 ml of Church buffer at 67°C overnight and then washed in 1×SSC/0.1% SDS at 68°C.

Graham A.N, & Kalitsis P. (2014). Chromosome Y Centromere Array Deletion Leads to Impaired Centromere Function. PLoS ONE, 9(1), e86875.

+ Open protocol

+ Expand

Northern Blot Analysis of agrA Transcripts

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the northern blot analysis of agrA transcripts, 5 µg of RNA samples were denatured and separated on a 1% agarose gel containing 10 mg/mL ethidium bromide. After visualization under UV light (loading control), the RNA from the gel was transferred to a Hybond-N+ nylon membrane (GE Healthcare Life Sciences) by overnight capillary blotting. The radioactive probes were generated by PCR amplification and were subsequently ³²P-radioactively-labeled using the Ready-to-Go DNA labeling Beads (GE Healthcare Life Sciences). Primers AgrA-F: CGAATGCCTACACATCAAGG and AgrA-R: CTTCACCACACCTTTTGTCG were used for the amplification of the agrA probe, while the primers for the chiA and chiB probes were the same as described in [18] (link). RNA hybridization was performed overnight at 65 °C in 0.5 M sodium phosphate buffer pH 7.2 containing 7% SDS. After washing in 20 mM sodium phosphate buffer pH 7.2 containing 1% SDS, the radioactive signal was detected with the aid of a Cyclone Plus Phosphor Imager (PerkinElmer) and analyzed with the accompanying OptiQuant software. Differences between the amounts of transcripts were considered relevant only if they exceeded 2-fold.
The northern blot analysis of lhrA was performed as described in [20] (link).

Paspaliari D.K., Mollerup M.S., Kallipolitis B.H., Ingmer H, & Larsen M.H. (2014). Chitinase Expression in Listeria monocytogenes Is Positively Regulated by the Agr System. PLoS ONE, 9(4), e95385.

+ Open protocol

+ Expand

Transcriptional Response to Colistin in S. aureus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exponential-phase cultures were adjusted to an OD₆₀₀ of 0.25 in warm MH broth, and 150 µg/ml colistin was added. At different time points, cells were harvested by centrifugation at 8,000 rpm for 3 min. The cells were lysed mechanically using the FastPrep system (Bio101; Qbiogene), and total RNA was extracted using a Qiagen RNeasy minikit according to the manufacturer’s instructions. RNA quantity and quality were measured on a NanoDrop ND-1000 spectrophotometer based on the absorbance (the A₂₆₀ and the A₂₆₀/A₂₈₀ and A₂₆₀/A₂₃₀ ratios, respectively). Four micrograms of RNA from each preparation was loaded onto a 1% agarose gel and transferred to a positively charged nylon membrane (GE Healthcare). The hybridization was performed using gene-specific probes labeled with [³²P]dCTP (PerkinElmer) and Ready-to-Go DNA-labeling beads from GE Healthcare. Internal fragments of the genes were amplified using the following primers: graR-forward, TGCTGGTATTGAAGATTTCG; graR-reverse, CCTACTTTTGTTTCGATTGC; vraR-forward, GTGGATGATCATGAAATGGT; vraR-reverse, TGGAATGCATAGATAACAGC; mprF-forward, CTGTGGTGTAATTGTTGACG; mprF-reverse, TAATTACCGCCGTACTGATT; dltB-forward, ACCAACAGGCAATGAATATC; dltB-reverse, TAAGTGCTGTTGTGAAACCA. The PCR products were used as the templates in the labeling reactions.

Haaber J., Friberg C., McCreary M., Lin R., Cohen S.N, & Ingmer H. (2015). Reversible Antibiotic Tolerance Induced in Staphylococcus aureus by Concurrent Drug Exposure. mBio, 6(1), e02268-14.

+ Open protocol

+ Expand

Molecular Characterization Techniques

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA and DNA isolation, segregation analysis, RT-PCR, and quantitative RT-PCR (qRT-PCR) analysis were performed by standard procedures (58 (link)). The oligodeoxynucleotides used are listed in Table S3 in the supplemental material. Southern blotting was performed by standard procedures (59 ) using ³²P-labeled DNA as a probe produced by PCR and radioactively labeled by use of Ready-to-Go DNA labeling beads from GE Healthcare (Munich, Germany). Genomic DNA was digested with HindIII.

Rudolf M., Tetik N., Ramos-León F., Flinner N., Ngo G., Stevanovic M., Burnat M., Pernil R., Flores E, & Schleiff E. (2015). The Peptidoglycan-Binding Protein SjcF1 Influences Septal Junction Function and Channel Formation in the Filamentous Cyanobacterium Anabaena. mBio, 6(4), e00376-15.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!