Gtx632269

Manufactured by GeneTex

The GTX632269 is a laboratory equipment product designed for scientific research and experimentation. This device serves as a tool for conducting various types of analyses and experiments within a controlled laboratory environment. The core function of this product is to facilitate the gathering and processing of data, enabling researchers to gather insights and findings. However, a more detailed description while maintaining an unbiased and factual approach is not available.

Automatically generated - may contain errors

Lab products found in correlation

Ab272504, by GeneTex (2 mentions) Pa5 34929, by GeneTex (2 mentions) Gtx125989, by Abcam (2 mentions) Prism 8, by GraphPad (2 mentions) Gtx632604, by GeneTex (2 mentions) Tcs sp2, by Leica (1 mentions) Alexa fluor 488, by Thermo Fisher Scientific (1 mentions) Prolong gold antifade, by Thermo Fisher Scientific (1 mentions) Anti ddx6, by Fortis Life Sciences (1 mentions) Protein g sepharose, by GE Healthcare (1 mentions) Protease inhibitor cocktail, by Nacalai Tesque (1 mentions) Anti ddx21 a300 627a, by Fortis Life Sciences (1 mentions) Anti g3bp1 a302 033a, by Fortis Life Sciences (1 mentions) Anti ddx6 a300 460a, by Fortis Life Sciences (1 mentions) Slowfade gold antifade reagent, by Thermo Fisher Scientific (1 mentions) Fv1200, by Olympus (1 mentions) Anti ha antibody 3f10, by Roche (1 mentions) Alexa fluor 594 conjugated secondary antibody, by Thermo Fisher Scientific (1 mentions) Lab tek 2 well chamber slide, by Thermo Fisher Scientific (1 mentions) Ab273434, by Abcam (1 mentions)

7 protocols using gtx632269

Protein and RNA Extraction for SARS-CoV-2 Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction from Trizol
was performed as described previously,^{41 (link)} while protein was extracted from the interphase using isopropanol
precipitation.^{42 (link)} The precipitated protein
was washed in ethanol, resuspended in 5× SDS-PAGE loading buffer,
sonicated for 10 s, and boiled for 10 min before 8% SDS-PAGE analysis.
Western blot was performed using antibodies directed against IAV HA
(Invitrogen, PA5-34929) and NP (GeneTex, GTX125989) and SARS-CoV-2
S (Abcam ab272504) and N (GeneTex, GTX632269). Membranes were washed
in TBS containing 0.1% tween-20. Spike RNA was purchased from IDT
and had the sequence 5′-AGUAGAAACAAGGCGGUAGGCGCUGUCCUUUAUCCAGACAACCAUUACCUGUCCACACAAUCUGCCCUUUCGAAAGAUCCCAACGAAAAGAGAGACCACAUGGUCCUUCCUGCUUUUGCU-3′.
Isolated RNA was reverse-transcribed using SuperScript III and a primer
binding to the 3′ end of the NA segment.^{41 (link)} qPCR was performed as described previously.^{41 (link)} Data was analyzed in Graphpad Prism 8 using
one-way ANOVA with multiple corrections.

Gopal V., Nilsson-Payant B.E., French H., Siegers J.Y., Yung W.S., Hardwick M, & te Velthuis A.J. (2021). Zinc-Embedded Polyamide Fabrics Inactivate SARS-CoV-2 and Influenza A Virus. ACS Applied Materials & Interfaces, 13(26), 30317-30325.

+ Open protocol

+ Expand

Immunofluorescence Analysis of SARS-CoV-2 Markers

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were fixed with 4% paraformaldehyde (CARLO ERBA Reagents, 387507) in PBS followed by permeabilization with 0.2% Triton X-100 (Sigma-Aldrich, T9284) in PBS. Cells were then labeled with the primary antibody anti-SARS-CoV Nucleocapsid Mouse [6H3] (GTX632269, GENETEX), SARS-CoV SPIKE [1A9] (GTX632604, GENETEX), dsRNA Mouse (10010200, SCICONS J2), DDX3X Rabbit (A5637, ABCLONAL), DDX3 Mouse (A10099, ABCLONAL), G3BP1 Rabbit (13057-2-AP, Proteintech) for 1 h at room temperature and visualized by means of Cy3 (jg715-156-150, Jackson ImmunoResearch) or Alexa Fluor 488 (A21206, Life Technologies) conjugated secondary antibodies. Coverslips were mounted in Prolong Gold antifade (P36935, Life Technologies) and examined under a confocal microscope (Leica TCS SP2). Digital images were acquired with the Leica software and the image adjustments and merging were performed by using the appropriated tools of ImageJ software. Quantification of colocalization, expressed in terms of Mander's overlap coefficient, was calculated using the JacoP plugin of ImageJ software, as previously described(Romagnoli et al., 2018 (link)). A minimum of 50 cells per sample experimental condition were counted for triplicate samples per condition in each experiment.

Ciccosanti F., Di Rienzo M., Romagnoli A., Colavita F., Refolo G., Castilletti C., Agrati C., Brai A., Manetti F., Botta L., Capobianchi M.R., Ippolito G., Piacentini M, & Fimia G.M. (2021). Proteomic analysis identifies the RNA helicase DDX3X as a host target against SARS-CoV-2 infection. Antiviral Research, 190, 105064.

+ Open protocol

+ Expand

SARS-CoV-2 Protein and RNA Detection

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction from Trizol was performed as described previously(36 (link)), while protein was extracted from the interphase using isopropanol precipitation(37 (link)). Precipitated protein was washed in ethanol, resuspended in 5x SDS-PAGE loading buffer, sonicated for 10 seconds, and boiled for 10 min before 8% SDS-PAGE analysis. Western blot was performed using antibodies directed against IAV HA (Invitrogen, PA5–34929) and NP (GeneTex, GTX125989) and SARS-CoV-2 S (Abcam ab272504) and N (GeneTex, GTX632269). Membranes were washed in TBS containing 0.1% tween-20. Spike RNA was purchased from IDT and had the sequence 5 -AGUAGAAACAAGGCGGUAGGCGCUGUCCUUUAUCCAGACAACCAUUACCUGUCCACACAAUCUGCCCUUUCGAAAGAUCCCAACGAAAAGAGAGACCACAUGGUCCUUCCUGCUUUUGCU-3 . Isolated RNA was reverse transcribed using SuperScript III and a primer binding to the 3′ end of the NA segment (36 (link)). qPCR was performed as described previously (36 (link)). Data was analysed in Graphpad Prism 8 using one-way ANOVA with multiple corrections.

Gopal V., Nilsson-Payant B.E., French H., Siegers J.Y., Yung W.S., Hardwick M, & te Velthuis A.J. (2021). Zinc-embedded fabrics inactivate SARS-CoV-2 and influenza A virus. bioRxiv.

+ Open protocol

+ Expand

SARS-CoV-2 Nucleocapsid Protein Interactome

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed in buffer containing 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 4 mM EDTA, 0.1% NP-40, 10 mM NaF, protease inhibitor cocktail (Nacalai Tesque, Kyoto, Japan). Lysates were precleared with 30 μL of protein-G-Sepharose (GE Healthcare Bio-Sciences). Precleared supernatants were incubated with 5 μg of anti-SARS-CoV-2 nucleocapsid antibody mixture (GTX135357 and GTX632269 [6H3]; GeneTex) or anti-DDX21 (A300-627A; Bethyl Lab), anti-DDX6 (A300-460A; Bethyl Lab), or anti-MOV10 (A301-571A; Bethyl Lab) antibody at 4°C for 1 h. Following absorption of the precipitates on 30 μL of protein G-Sepharose resin for 1 h, the resin was washed four times with 700 μL of lysis buffer. Proteins were eluted by boiling the resin for 5 min in 2× Laemmli sample buffer. The proteins were then subjected to SDS-PAGE, followed by immunoblot analysis using anti-SARS-CoV-2 nucleocapsid (GTX632269 [6H3]), anti-DDX21, anti-DDX6, or anti-MOV10 antibody.

, & Ariumi Y. (2022). Host Cellular RNA Helicases Regulate SARS-CoV-2 Infection. Journal of Virology, 96(6), e00002-22.

+ Open protocol

+ Expand

Immunofluorescence Staining of Cellular Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were grown on Lab-Tek 2-well chamber slides (Nunc, Thermo) at 2 × 10⁴ cells per well. The cells were fixed in 3.6% formaldehyde in phosphate-buffered saline (PBS), permeabilized in 0.1% NP-40 in PBS at room temperature, and incubated with anti-HA antibody (3F10; F. Hoffmann-La Roche AG, Basel, Switzerland) at a 1:300 dilution in PBS containing 3% bovine serum albumin (BSA) at 37°C for 30 min. I also used anti-DDX6 (A300-460A; Bethyl Lab), anti-XRN1 (A300-443A; Bethyl Lab), anti-G3BP1 (A302-033A; Bethyl), anti-DDX21 (A300-627A; Bethyl Lab), anti-MOV10 (A301-571A; Bethyl Lab), anti-DDX5 (A300-523A; Bethyl Lab), and anti-SARS-CoV-2 nucleocapsid (ab273434 [6H3]; Abcam or GTX632269 [6H3]; GeneTex) antibodies as primary antibodies. Cells were then stained with donkey anti-mouse IgG (H+L) Alexa Fluor 594-conjugated secondary antibody and/or donkey anti-rabbit or anti-rat IgG (H+L) Alexa Fluor 594-conjugated secondary antibody (Thermo Fisher Scientific Inc., Waltham, MA, USA), at a 1:300 dilution in PBS containing 3% BSA at 37°C for 30 min. Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole). Following washing 3 times in PBS, the cover slides were mounted on slides using SlowFade Gold antifade reagent (Life Technology). Samples were analyzed under a confocal laser-scanning microscope (FV1200; Olympus, Tokyo, Japan).

, & Ariumi Y. (2022). Host Cellular RNA Helicases Regulate SARS-CoV-2 Infection. Journal of Virology, 96(6), e00002-22.

+ Open protocol

+ Expand

Western Blot Analysis of SARS-CoV-2 N Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

At 24 h post-inoculation, the cells were washed three times with PBS and harvested. Cell lysis was performed using 2× laemmli sample buffer (S3401, Sigma) and boiling at 95 °C. The cell lysates were then centrifuged (9000 × g for 1 min), and the supernatants were loaded on an SDS-polyacrylamide gel. After electrophoresis, the separated proteins were transferred to a nitrocellulose membrane and blocked overnight with 5% skim milk in PBS solution containing 0.05% Tween 20 (PBS-T) at 4 °C. The membranes were treated with an anti-HO-1 antibody (SAB1405949, Sigma), anti-GAPDH antibody (ab8245, Abcam), or anti-SARS-CoV-2 N antibody (GTX632269, GeneTex) in 2.5% skim milk-PBS-T for 1 h at room temperature. The membranes were then washed three times with PBS-T for 10 min in each round, treated for 1 h with a secondary antibody tagged with horseradish peroxidase in 2.5% skim milk-PBS-T solution, and washed three times with PBS-T for 10 min in each round. The protein bands were visualized using the SuperSignal™ West Pico PLUS Chemiluminescent Substrate (Sigma).

Kim D.H., Ahn H.S., Go H.J., Kim D.Y., Kim J.H., Lee J.B., Park S.Y., Song C.S., Lee S.W., Ha S.D., Choi C, & Choi I.S. (2021). Hemin as a novel candidate for treating COVID-19 via heme oxygenase-1 induction. Scientific Reports, 11, 21462.

+ Open protocol

+ Expand

SARS-CoV-2 Protein Detection Immunoblot

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested, treated with 3 × sodium dodecyl sulfate (SDS) sample buffer, denatured at 37 °C for 1 h, and subjected to 8% SDS-polyacrylamide gel electrophoresis. Proteins were immunoblotted onto polyvinylidene fluoride membranes and stained with mouse monoclonal anti-spike (GTX632604; GeneTex, Hsinchu, Taiwan, 1: 5000) or mouse monoclonal anti-nucleocapsid (GTX632269, GeneTex, 1: 2000) antibodies. Mouse monoclonal GAPDH (GTX627408, GeneTex, 1: 5000) was used as the loading control.

Tang W.F., Tsai H.P., Chang Y.H., Chang T.Y., Hsieh C.F., Lin C.Y., Lin G.H., Chen Y.L., Jheng J.R., Liu P.C., Yang C.M., Chin Y.F., Chen C.C., Kau J.H., Hung Y.J., Hsieh P.S, & Horng J.T. (2021). Perilla (Perilla frutescens) leaf extract inhibits SARS-CoV-2 via direct virus inactivation. Biomedical Journal, 44(3), 293-303.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!