Mir 219 mimics

Manufactured by Qiagen

Sourced in United States

MiR-219 mimics is a laboratory equipment product offered by Qiagen. It is designed to function as a synthetic miRNA that mimics the natural expression of miR-219, a microRNA involved in various biological processes. The core function of MiR-219 mimics is to provide a tool for researchers to study the role and effects of miR-219 in their scientific investigations.

Automatically generated - may contain errors

Lab products found in correlation

Morpholino, by Gene Tools (2 mentions) Pressure injector, by World Precision Instruments (2 mentions)

Spelling variants of this product

MiR-mimics (4 citations)

2 protocols using mir 219 mimics

Axolotl Regeneration: miR-219 and Morpholino Modulation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Microinjections of miR-219 mimics (Qiagen), morpholinos (Gene Tools, Philomath, OR, USA) or controls were carried out as previously described in Erickson and Echeverri.^{53 (link)} Briefly, miR-219 mimic or control was diluted to a final concentration of 10 μM in PBS plus Fast Green. morpholinos were diluted to a final concentration of 1 mmol/l in sterile DI water plus Fast Green. World Precision Instruments pressure injector was used to inject the solutions directly into the wound bed every other day until collection. Post injection, axolotls are placed in PBS and electroporated with five pulses of 50 V, 50 ms each. When tissue samples were harvested at 7 or 21 days post injury multiple injection of the morpholino, mimics or controls were given over that time period.
Am Sall4 Morpholino: GACCTGGAAAAAACCCAGTCATTGC
Control Morpholino: GAACTGCAAAAAAACAGTAATTCC

Erickson J.R., Gearhart M.D., Honson D.D., Reid T.A., Gardner M.K., Moriarity B.S, & Echeverri K. (2016). A novel role for SALL4 during scar-free wound healing in axolotl. NPJ Regenerative Medicine, 1, 16016-.

+ Open protocol

+ Expand

Microinjection and Electroporation of miR-219 Mimics and Morpholinos in Axolotl Limb Regeneration

Check if the same lab product or an alternative is used in the 5 most similar protocols

Microinjections of miR-219 mimics (Qiagen), morpholinos (Gene Tools, Philomath, OR, USA) or controls were carried out as previously described in Erickson and Echeverri.^{53 (link)} Briefly, miR-219 mimic or control was diluted to a final concentration of 10 μM in PBS plus Fast Green. morpholinos were diluted to a final concentration of 1 mmol/l in sterile DI water plus Fast Green. World Precision Instruments pressure injector was used to inject the solutions directly into the wound bed every other day until collection. Post injection, axolotls are placed in PBS and electroporated with five pulses of 50 V, 50 ms each. When tissue samples were harvested at 7 or 21 days post injury multiple injection of the morpholino, mimics or controls were given over that time period.
Am Sall4 Morpholino:
GACCTGGAAAAAACCCAGTCATTGC
Control Morpholino:
GAACTGCAAAAAAACAGTAATTCC

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!